ID: 1137927275

View in Genome Browser
Species Human (GRCh38)
Location 16:52552322-52552344
Sequence GGTCTTTGTGGACAACACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137927275_1137927285 30 Left 1137927275 16:52552322-52552344 CCCTGGTGTTGTCCACAAAGACC 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1137927285 16:52552375-52552397 GTACTTTCTTCGCAAATGGGTGG 0: 1
1: 0
2: 1
3: 2
4: 48
1137927275_1137927282 26 Left 1137927275 16:52552322-52552344 CCCTGGTGTTGTCCACAAAGACC 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1137927282 16:52552371-52552393 CCCAGTACTTTCTTCGCAAATGG 0: 1
1: 0
2: 0
3: 3
4: 84
1137927275_1137927284 27 Left 1137927275 16:52552322-52552344 CCCTGGTGTTGTCCACAAAGACC 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1137927284 16:52552372-52552394 CCAGTACTTTCTTCGCAAATGGG 0: 1
1: 0
2: 0
3: 1
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137927275 Original CRISPR GGTCTTTGTGGACAACACCA GGG (reversed) Intergenic
900183209 1:1321420-1321442 GGTCTGTGGGGCCAACACCTCGG + Intronic
901713542 1:11134859-11134881 GGTATTTGTTTACAACACCAGGG + Intronic
903649229 1:24912959-24912981 GGTCTCAGTGGACTCCACCAGGG + Intronic
905492724 1:38357058-38357080 TGTCTTTGTGGAAAAGGCCAAGG + Intergenic
905867515 1:41384116-41384138 TGTCTTCCTGGACTACACCATGG + Intergenic
905899604 1:41572556-41572578 GGTGCTTGGGGACTACACCAAGG - Intronic
907221543 1:52910842-52910864 GGCCTTTGAGGACCCCACCACGG - Intronic
910118325 1:83757129-83757151 GCTCTGTGTGGGCTACACCAGGG - Intergenic
911620420 1:100060922-100060944 GGCCTTTGTAGATAACACCATGG - Intronic
921056951 1:211549560-211549582 GGTCCTTGAGGAGGACACCAGGG + Intergenic
921750164 1:218782985-218783007 GGTCTTTGTGGATAAATCGATGG + Intergenic
1070656383 10:78274523-78274545 GCTCCTTGTGTCCAACACCAAGG - Intergenic
1071876064 10:89844639-89844661 GGTCTTTGTTGACAGAATCAGGG - Intergenic
1072256498 10:93626296-93626318 GGTATTTCTGGACAACAAAAGGG + Intronic
1074350244 10:112729797-112729819 TGTCTTTGTAGATTACACCAAGG - Intronic
1074644100 10:115424350-115424372 GCTGTTTGTGGACAACAGTATGG + Intronic
1076343735 10:129766717-129766739 GGTCTTTGGGGTCAAGGCCAAGG - Intronic
1080905753 11:36543213-36543235 AGTCTCTGTGGACATCACCCTGG + Intronic
1080961772 11:37168741-37168763 GCACTGTGTGGACACCACCAAGG + Intergenic
1082616065 11:55361089-55361111 GGTGTTTTTGGACAAGACTATGG - Intergenic
1083378746 11:62246924-62246946 GGTCCTTGTGTGCAACACAAGGG - Intergenic
1084678922 11:70653951-70653973 GGTCTCCGAGGAAAACACCAGGG + Intronic
1084848369 11:71918701-71918723 GATCTGTGTGGAGAACTCCAAGG - Intronic
1089288029 11:117420147-117420169 GGGCTCTGTCGGCAACACCAAGG - Intergenic
1090217979 11:124987585-124987607 GGTCTTTGTGGAGAACATGCTGG - Exonic
1090218024 11:124987924-124987946 GGTCTTTGGGAAGAACACCTTGG - Exonic
1090459664 11:126879484-126879506 GGTCCTTCTGATCAACACCATGG + Intronic
1092572746 12:9743157-9743179 GGTGTTTGTCAAAAACACCAGGG - Intergenic
1093027546 12:14258633-14258655 GGACTTTGTGTACAACTCCTAGG - Intergenic
1095288364 12:40444089-40444111 GGTCTTTGTGGAAATAACAATGG + Exonic
1096038709 12:48495166-48495188 GGTCTCTGTGGTCAAGACAAAGG + Intronic
1096263630 12:50107605-50107627 GGGCTTTGGCGACAACACCAAGG + Exonic
1096316403 12:50570970-50570992 GCTCCTTGTGGACAACAGCTGGG - Intronic
1097635634 12:62118153-62118175 ATTCTTTGTGTACAACAGCAAGG - Intronic
1098532569 12:71557642-71557664 GGTTCTTGTGGGCCACACCAGGG + Intronic
1105061010 12:133151048-133151070 TGTATTTGTGGACTTCACCAGGG + Exonic
1106887822 13:34208892-34208914 GGTCTTTGATGGCACCACCAGGG - Intergenic
1107734455 13:43383626-43383648 AGTCTTTGTGGAGAGTACCATGG - Intronic
1109865591 13:68259646-68259668 GGTGTTTGAGGATAAAACCATGG + Intergenic
1113187220 13:107702610-107702632 GGTCTGTGCGGCAAACACCATGG - Intronic
1113573322 13:111374249-111374271 GGTATTTGTGAACAAAACCCTGG + Intergenic
1114215108 14:20651946-20651968 GGACTTTGGAGACATCACCAAGG - Intergenic
1114785649 14:25594760-25594782 AGTCTTGGTGGGCAACACTATGG - Intergenic
1115033153 14:28822938-28822960 AGTCATTGTGGAAAACACTATGG + Intergenic
1115643790 14:35352714-35352736 GGCCTTTGTGGAGAGCACCAAGG + Intergenic
1121821279 14:96969378-96969400 AGTCATTGTGGACAACAGTATGG + Intergenic
1122425476 14:101602961-101602983 GGCCCCTGTGGACAACGCCAGGG + Intergenic
1122623976 14:103074991-103075013 TGTCTGTGTGCACAGCACCAGGG + Intergenic
1124169705 15:27361430-27361452 GCTGTTTGAGGAGAACACCAAGG - Intronic
1126274461 15:46860550-46860572 GGTGTTTGTGGACTTCACTAAGG + Intergenic
1127885786 15:63199420-63199442 TTTGTTTGTGGACAACACCCTGG - Intronic
1128757518 15:70193604-70193626 GGGCTTTGTAGACAACACCGAGG + Intergenic
1131301950 15:91207468-91207490 GGTCTGTGTGGTCCCCACCAAGG + Intronic
1132375534 15:101326019-101326041 GGCCTGTGAGGACAGCACCAGGG + Intronic
1132625385 16:889122-889144 GATCTCTGTGGACTCCACCAGGG - Intronic
1135198107 16:20411406-20411428 GGGCTTTGGGGACAACACATAGG - Intronic
1135220122 16:20607164-20607186 GGGCTTTGGGGACAACACAGAGG + Intergenic
1137927275 16:52552322-52552344 GGTCTTTGTGGACAACACCAGGG - Intergenic
1138822058 16:60272724-60272746 TGTATTTGTGGAAAACACGATGG + Intergenic
1139748595 16:69094534-69094556 TTTCTCTGTGGACAAGACCAGGG + Intergenic
1146311663 17:31773522-31773544 GCTCTCTGTTGACATCACCATGG - Intergenic
1146467626 17:33098782-33098804 GCTCTGTGTGGAAAAAACCAAGG + Intronic
1155140714 18:23041961-23041983 GGTCTTTGTGGACACCAACCGGG - Intergenic
1161035026 19:2079748-2079770 GGTCTTTGTGGATGAAATCAAGG - Intronic
1168512419 19:56983493-56983515 GGTCTTTGTCCACAATAGCATGG + Intergenic
926237158 2:11054625-11054647 GGCCCTTGTGAACATCACCACGG - Intergenic
926439730 2:12875363-12875385 GATCTTTGTGGACTGCATCAAGG + Intergenic
928447872 2:31349068-31349090 CATCTTTGTGGGCAACCCCAAGG - Intronic
930498874 2:52185438-52185460 TGTTTTTATGTACAACACCAGGG + Intergenic
931058545 2:58500777-58500799 GTTCTCAGTGGAAAACACCAGGG - Intergenic
935517748 2:104063961-104063983 AGTCTTTGTGGAAAATAGCATGG + Intergenic
936059204 2:109283483-109283505 GACCTTTGTGGACAACACCAGGG - Intronic
936411240 2:112260111-112260133 ATTCTTTGTTGAAAACACCAAGG - Intergenic
936890236 2:117360537-117360559 GGTCTTTCTGGAACACATCAGGG + Intergenic
938381729 2:130839974-130839996 GGTCTTTGTTGGCTAAACCATGG + Intronic
939002074 2:136748035-136748057 GCACTTTGTGGTCAACTCCAAGG + Intergenic
944226254 2:197351431-197351453 GGTGTGTGTGGGCAACAGCAAGG - Intergenic
944474764 2:200092425-200092447 AGCATTTGTGGACAAGACCAAGG + Intergenic
947235719 2:227938714-227938736 GGTCTTTGTGGACATTACTGAGG - Intergenic
1174917640 20:54670008-54670030 AGTGTTTGTGGACAAAACTATGG - Intergenic
1174961202 20:55159162-55159184 GGTCTTCTTTGACATCACCATGG + Intergenic
1175542594 20:59757130-59757152 GGGCTGTGGGGACCACACCACGG - Intronic
1176166327 20:63675914-63675936 GGCCTGTGTGAACATCACCACGG + Intronic
1177631059 21:23728372-23728394 CGTCATTGTGGAGAAGACCAAGG + Intergenic
1184130747 22:42515176-42515198 GCTCTCTGTGGACACCAGCAGGG + Exonic
1184140926 22:42577006-42577028 GCTCTCTGTGGACACCAGCAGGG + Intergenic
949648800 3:6130797-6130819 GGTCATTGTGGAAAACAGCTTGG - Intergenic
953156560 3:40380511-40380533 TGACTTTGTGGACAACATCCAGG - Intergenic
956560249 3:70567038-70567060 GGGCATTGTGGCCAACAGCAGGG - Intergenic
957583081 3:82101431-82101453 GGTTTTTGTGGACAAAAGTATGG - Intergenic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961459244 3:127039770-127039792 ACTCCTTGAGGACAACACCAGGG + Intergenic
964680081 3:159328707-159328729 GGTGTTTGGGCACCACACCAGGG + Intronic
965484847 3:169266255-169266277 TGTGTTTATGGGCAACACCAAGG - Intronic
968222369 3:196948372-196948394 GGTCCTTGTGTAGAAGACCAGGG + Exonic
968925552 4:3545444-3545466 GGTGTTTGTGGATAACACTTGGG + Intergenic
971154490 4:24066652-24066674 GTTCTTGGTGGAAAACCCCAGGG - Intergenic
971653106 4:29305058-29305080 GGTCTTTAGGGATAATACCATGG - Intergenic
973027202 4:45287550-45287572 AATCTTTGTGGAAAACAGCACGG - Intergenic
973685393 4:53365113-53365135 GGTTTTTGTGGACAGAACCCTGG - Exonic
974216994 4:58860921-58860943 GGAGTTTGAGGACAACACCAAGG - Intergenic
974351385 4:60751379-60751401 GGTCTGTGTGAACAACATAAGGG - Intergenic
975506760 4:75146879-75146901 AGTCTTTGTAGACAATATCATGG - Intergenic
976422985 4:84866810-84866832 GTTCTTTGTGGAAAACGCCAAGG + Intronic
980463889 4:133150428-133150450 GGTCTTTCTGGAGAACCCCCTGG + Exonic
984585616 4:181560882-181560904 TTTTTTTGTGGACAACAACAAGG + Intergenic
991195942 5:63932272-63932294 ACTCTTTGTGGATAAAACCAAGG + Intergenic
991965001 5:72081995-72082017 GGTCTTTGTCCACAAAACCCAGG + Intergenic
995398120 5:111710998-111711020 GGTCTATGTGGAAAATTCCAAGG - Intronic
997672123 5:135683777-135683799 GGACTTTGGGAACAACCCCATGG + Intergenic
998309028 5:141108275-141108297 GGACTATGTGGAAAACATCATGG + Intronic
1000585652 5:163095185-163095207 AGTCCTTGTGGGAAACACCAGGG - Intergenic
1000671287 5:164066270-164066292 GGTGGTTGTGGAAAACACAAGGG + Intergenic
1001200766 5:169714179-169714201 GAGCTTTGTGGAGCACACCAGGG - Exonic
1005421148 6:25652385-25652407 GGTCTTCGTCGTCAACACCATGG + Exonic
1006254608 6:32820446-32820468 CTTCTTTGTAGACAGCACCATGG + Intronic
1006581945 6:35082341-35082363 GGTCTTTGTGCAGAACAGCCTGG + Intronic
1008554027 6:52657525-52657547 AGTCTTGGTGGGCAACTCCAAGG + Intergenic
1008589134 6:52975765-52975787 GTTCTTTGAGGAAAAAACCAGGG - Intergenic
1008878195 6:56352294-56352316 CGACTATGTGGACTACACCATGG - Intronic
1009864622 6:69381357-69381379 GGTGTTTGAGGACAAGAACATGG - Intronic
1017338330 6:153288838-153288860 GGTCTATGTAGAAAACTCCAAGG - Intergenic
1017927316 6:158921688-158921710 AATCGTTGTGCACAACACCATGG - Intergenic
1018705300 6:166459980-166460002 GGACTTTGGGGCCAGCACCACGG + Intronic
1019160024 6:170063364-170063386 GGTCTTTGCAGACACCACCGAGG - Intergenic
1020355781 7:7274170-7274192 AGTCCTTGTGGAAAACACAAAGG - Intergenic
1021172343 7:17413984-17414006 GGTGTTGGTGAACAACAGCAAGG + Intergenic
1023036354 7:36134771-36134793 GGCCACTGTGGAAAACACCAAGG + Intergenic
1023417633 7:39948152-39948174 GGCCTGGGTGGGCAACACCATGG - Intergenic
1031684087 7:124710501-124710523 GATCTTTCTGGCCAGCACCATGG - Intergenic
1033137580 7:138797950-138797972 GGTGTTTGGGGGAAACACCATGG - Exonic
1035306214 7:157934057-157934079 GCTCTTTGTCGAGAACACCAGGG + Intronic
1035648481 8:1246886-1246908 GGTCTTGCTGGACACCAACATGG - Intergenic
1036005675 8:4660200-4660222 GTTCTTTGTAGAAAACCCCAAGG + Intronic
1042733251 8:71960653-71960675 GGTCTTTGGGAACAACAGAAAGG + Intronic
1043604516 8:81983807-81983829 GCTCTTTGTGGACAGGAACAGGG + Intergenic
1046140120 8:110080531-110080553 AGTCTTTGTGGAAAACAGTATGG + Intergenic
1047353354 8:124096828-124096850 GGTCTCTGGGGTCAACACAAGGG + Intronic
1049680967 8:143917988-143918010 TGTCTTCGTGGACGCCACCAAGG - Exonic
1050389371 9:5122509-5122531 TGTCTCTGTAGACAGCACCAAGG - Intronic
1053093499 9:35302647-35302669 GTTCTTTGGGCACAACTCCAGGG - Intronic
1054464449 9:65485166-65485188 GGTGTTTGTGGATAACACTTGGG - Intergenic
1055570574 9:77612751-77612773 AGTCTTTGTGGAAAACAGTATGG + Intronic
1055740425 9:79382462-79382484 GGTCTTTGTGGGAAACAGAATGG - Intergenic
1056508010 9:87275782-87275804 ACTCTTTTTGGACAACACTAGGG + Intergenic
1057294204 9:93825987-93826009 GGACTTTGTGGGCAACAACCTGG - Intergenic
1059039752 9:110799913-110799935 GTTTTTTGTTGACAACACCATGG - Intronic
1185479798 X:437876-437898 CGCCTTTGTAGACAACGCCACGG + Intergenic
1186036602 X:5429740-5429762 GGTCTTTGAGGTCAGCACCAGGG + Intergenic
1186186656 X:7026929-7026951 AGTCATTGTGGACAGCACCATGG - Intergenic
1190455064 X:50619006-50619028 GGGCTTTGTTGACATCAGCAAGG + Intronic
1190797659 X:53759777-53759799 GGGCTTCCTGGACCACACCATGG - Intergenic
1190917491 X:54821392-54821414 GGGCTTCCTGGACCACACCATGG + Intergenic
1193834388 X:86323659-86323681 GGAGCCTGTGGACAACACCAGGG + Intronic
1198450002 X:136757618-136757640 AGTGTTTGGGGAAAACACCATGG - Intronic
1199925988 X:152464612-152464634 GGTCATTGTGGAATACACTAGGG + Intergenic
1201634198 Y:16104248-16104270 GGCCTTTGAGGTCAGCACCAGGG - Intergenic