ID: 1137930628

View in Genome Browser
Species Human (GRCh38)
Location 16:52584052-52584074
Sequence CTGGAGGCACAGGGTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137930628_1137930639 -3 Left 1137930628 16:52584052-52584074 CCTCCCTCACCCTGTGCCTCCAG No data
Right 1137930639 16:52584072-52584094 CAGGTGGCTTGGAAAGCAGGAGG No data
1137930628_1137930637 -6 Left 1137930628 16:52584052-52584074 CCTCCCTCACCCTGTGCCTCCAG No data
Right 1137930637 16:52584069-52584091 CTCCAGGTGGCTTGGAAAGCAGG No data
1137930628_1137930642 13 Left 1137930628 16:52584052-52584074 CCTCCCTCACCCTGTGCCTCCAG No data
Right 1137930642 16:52584088-52584110 CAGGAGGCGATGAAGGCTGTGGG No data
1137930628_1137930641 12 Left 1137930628 16:52584052-52584074 CCTCCCTCACCCTGTGCCTCCAG No data
Right 1137930641 16:52584087-52584109 GCAGGAGGCGATGAAGGCTGTGG No data
1137930628_1137930640 6 Left 1137930628 16:52584052-52584074 CCTCCCTCACCCTGTGCCTCCAG No data
Right 1137930640 16:52584081-52584103 TGGAAAGCAGGAGGCGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137930628 Original CRISPR CTGGAGGCACAGGGTGAGGG AGG (reversed) Intergenic
No off target data available for this crispr