ID: 1137930637

View in Genome Browser
Species Human (GRCh38)
Location 16:52584069-52584091
Sequence CTCCAGGTGGCTTGGAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137930630_1137930637 -9 Left 1137930630 16:52584055-52584077 CCCTCACCCTGTGCCTCCAGGTG No data
Right 1137930637 16:52584069-52584091 CTCCAGGTGGCTTGGAAAGCAGG No data
1137930626_1137930637 6 Left 1137930626 16:52584040-52584062 CCCAATCAACTGCCTCCCTCACC No data
Right 1137930637 16:52584069-52584091 CTCCAGGTGGCTTGGAAAGCAGG No data
1137930628_1137930637 -6 Left 1137930628 16:52584052-52584074 CCTCCCTCACCCTGTGCCTCCAG No data
Right 1137930637 16:52584069-52584091 CTCCAGGTGGCTTGGAAAGCAGG No data
1137930627_1137930637 5 Left 1137930627 16:52584041-52584063 CCAATCAACTGCCTCCCTCACCC No data
Right 1137930637 16:52584069-52584091 CTCCAGGTGGCTTGGAAAGCAGG No data
1137930621_1137930637 30 Left 1137930621 16:52584016-52584038 CCCCAAGAGGTGGACCTTTATGG No data
Right 1137930637 16:52584069-52584091 CTCCAGGTGGCTTGGAAAGCAGG No data
1137930623_1137930637 29 Left 1137930623 16:52584017-52584039 CCCAAGAGGTGGACCTTTATGGA No data
Right 1137930637 16:52584069-52584091 CTCCAGGTGGCTTGGAAAGCAGG No data
1137930625_1137930637 16 Left 1137930625 16:52584030-52584052 CCTTTATGGACCCAATCAACTGC No data
Right 1137930637 16:52584069-52584091 CTCCAGGTGGCTTGGAAAGCAGG No data
1137930631_1137930637 -10 Left 1137930631 16:52584056-52584078 CCTCACCCTGTGCCTCCAGGTGG No data
Right 1137930637 16:52584069-52584091 CTCCAGGTGGCTTGGAAAGCAGG No data
1137930624_1137930637 28 Left 1137930624 16:52584018-52584040 CCAAGAGGTGGACCTTTATGGAC No data
Right 1137930637 16:52584069-52584091 CTCCAGGTGGCTTGGAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137930637 Original CRISPR CTCCAGGTGGCTTGGAAAGC AGG Intergenic
No off target data available for this crispr