ID: 1137930639

View in Genome Browser
Species Human (GRCh38)
Location 16:52584072-52584094
Sequence CAGGTGGCTTGGAAAGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137930625_1137930639 19 Left 1137930625 16:52584030-52584052 CCTTTATGGACCCAATCAACTGC No data
Right 1137930639 16:52584072-52584094 CAGGTGGCTTGGAAAGCAGGAGG No data
1137930626_1137930639 9 Left 1137930626 16:52584040-52584062 CCCAATCAACTGCCTCCCTCACC No data
Right 1137930639 16:52584072-52584094 CAGGTGGCTTGGAAAGCAGGAGG No data
1137930628_1137930639 -3 Left 1137930628 16:52584052-52584074 CCTCCCTCACCCTGTGCCTCCAG No data
Right 1137930639 16:52584072-52584094 CAGGTGGCTTGGAAAGCAGGAGG No data
1137930631_1137930639 -7 Left 1137930631 16:52584056-52584078 CCTCACCCTGTGCCTCCAGGTGG No data
Right 1137930639 16:52584072-52584094 CAGGTGGCTTGGAAAGCAGGAGG No data
1137930627_1137930639 8 Left 1137930627 16:52584041-52584063 CCAATCAACTGCCTCCCTCACCC No data
Right 1137930639 16:52584072-52584094 CAGGTGGCTTGGAAAGCAGGAGG No data
1137930630_1137930639 -6 Left 1137930630 16:52584055-52584077 CCCTCACCCTGTGCCTCCAGGTG No data
Right 1137930639 16:52584072-52584094 CAGGTGGCTTGGAAAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137930639 Original CRISPR CAGGTGGCTTGGAAAGCAGG AGG Intergenic
No off target data available for this crispr