ID: 1137930641

View in Genome Browser
Species Human (GRCh38)
Location 16:52584087-52584109
Sequence GCAGGAGGCGATGAAGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137930635_1137930641 2 Left 1137930635 16:52584062-52584084 CCTGTGCCTCCAGGTGGCTTGGA No data
Right 1137930641 16:52584087-52584109 GCAGGAGGCGATGAAGGCTGTGG No data
1137930631_1137930641 8 Left 1137930631 16:52584056-52584078 CCTCACCCTGTGCCTCCAGGTGG No data
Right 1137930641 16:52584087-52584109 GCAGGAGGCGATGAAGGCTGTGG No data
1137930630_1137930641 9 Left 1137930630 16:52584055-52584077 CCCTCACCCTGTGCCTCCAGGTG No data
Right 1137930641 16:52584087-52584109 GCAGGAGGCGATGAAGGCTGTGG No data
1137930636_1137930641 -4 Left 1137930636 16:52584068-52584090 CCTCCAGGTGGCTTGGAAAGCAG No data
Right 1137930641 16:52584087-52584109 GCAGGAGGCGATGAAGGCTGTGG No data
1137930628_1137930641 12 Left 1137930628 16:52584052-52584074 CCTCCCTCACCCTGTGCCTCCAG No data
Right 1137930641 16:52584087-52584109 GCAGGAGGCGATGAAGGCTGTGG No data
1137930626_1137930641 24 Left 1137930626 16:52584040-52584062 CCCAATCAACTGCCTCCCTCACC No data
Right 1137930641 16:52584087-52584109 GCAGGAGGCGATGAAGGCTGTGG No data
1137930627_1137930641 23 Left 1137930627 16:52584041-52584063 CCAATCAACTGCCTCCCTCACCC No data
Right 1137930641 16:52584087-52584109 GCAGGAGGCGATGAAGGCTGTGG No data
1137930633_1137930641 3 Left 1137930633 16:52584061-52584083 CCCTGTGCCTCCAGGTGGCTTGG No data
Right 1137930641 16:52584087-52584109 GCAGGAGGCGATGAAGGCTGTGG No data
1137930638_1137930641 -7 Left 1137930638 16:52584071-52584093 CCAGGTGGCTTGGAAAGCAGGAG No data
Right 1137930641 16:52584087-52584109 GCAGGAGGCGATGAAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137930641 Original CRISPR GCAGGAGGCGATGAAGGCTG TGG Intergenic
No off target data available for this crispr