ID: 1137932290

View in Genome Browser
Species Human (GRCh38)
Location 16:52600557-52600579
Sequence CTAGTTTAGCTGGGCCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137932286_1137932290 -1 Left 1137932286 16:52600535-52600557 CCTGTAAACTAGTTTATGTGTCC No data
Right 1137932290 16:52600557-52600579 CTAGTTTAGCTGGGCCCAGCTGG No data
1137932283_1137932290 30 Left 1137932283 16:52600504-52600526 CCATGTAAATCCTTAGATATCTT No data
Right 1137932290 16:52600557-52600579 CTAGTTTAGCTGGGCCCAGCTGG No data
1137932285_1137932290 20 Left 1137932285 16:52600514-52600536 CCTTAGATATCTTAGGATAAACC No data
Right 1137932290 16:52600557-52600579 CTAGTTTAGCTGGGCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137932290 Original CRISPR CTAGTTTAGCTGGGCCCAGC TGG Intergenic
No off target data available for this crispr