ID: 1137935291 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:52629219-52629241 |
| Sequence | ATTTGAGGATCTGACTCCGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 68 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 61} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1137935291_1137935296 | 26 | Left | 1137935291 | 16:52629219-52629241 | CCAACGGAGTCAGATCCTCAAAT | 0: 1 1: 0 2: 0 3: 6 4: 61 |
||
| Right | 1137935296 | 16:52629268-52629290 | CACCCCCTGATCAGAAAAGAAGG | 0: 1 1: 0 2: 0 3: 10 4: 134 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1137935291 | Original CRISPR | ATTTGAGGATCTGACTCCGT TGG (reversed) | Intergenic | ||