ID: 1137935293

View in Genome Browser
Species Human (GRCh38)
Location 16:52629234-52629256
Sequence AGCGATCTCCTGGCAATTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 71}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137935293_1137935296 11 Left 1137935293 16:52629234-52629256 CCTCAAATTGCCAGGAGATCGCT 0: 1
1: 0
2: 0
3: 9
4: 71
Right 1137935296 16:52629268-52629290 CACCCCCTGATCAGAAAAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137935293 Original CRISPR AGCGATCTCCTGGCAATTTG AGG (reversed) Intergenic