ID: 1137935294

View in Genome Browser
Species Human (GRCh38)
Location 16:52629244-52629266
Sequence CAGTTTGGATAGCGATCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 43}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137935294_1137935296 1 Left 1137935294 16:52629244-52629266 CCAGGAGATCGCTATCCAAACTG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1137935296 16:52629268-52629290 CACCCCCTGATCAGAAAAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137935294 Original CRISPR CAGTTTGGATAGCGATCTCC TGG (reversed) Intergenic