ID: 1137948979

View in Genome Browser
Species Human (GRCh38)
Location 16:52764024-52764046
Sequence AAGAGAGAGCCGGGAGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137948979_1137948983 -10 Left 1137948979 16:52764024-52764046 CCTCCAACTCCCGGCTCTCTCTT No data
Right 1137948983 16:52764037-52764059 GCTCTCTCTTTTTCCCTTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137948979 Original CRISPR AAGAGAGAGCCGGGAGTTGG AGG (reversed) Intergenic
No off target data available for this crispr