ID: 1137949946

View in Genome Browser
Species Human (GRCh38)
Location 16:52774165-52774187
Sequence TTTTTATTTTTTCGTAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137949946_1137949948 -6 Left 1137949946 16:52774165-52774187 CCATCTCTACGAAAAAATAAAAA No data
Right 1137949948 16:52774182-52774204 TAAAAATTAGTCTGGCGTGATGG No data
1137949946_1137949951 26 Left 1137949946 16:52774165-52774187 CCATCTCTACGAAAAAATAAAAA No data
Right 1137949951 16:52774214-52774236 AATCCCAGCTATTCAGAAGGTGG No data
1137949946_1137949954 30 Left 1137949946 16:52774165-52774187 CCATCTCTACGAAAAAATAAAAA No data
Right 1137949954 16:52774218-52774240 CCAGCTATTCAGAAGGTGGAAGG No data
1137949946_1137949950 23 Left 1137949946 16:52774165-52774187 CCATCTCTACGAAAAAATAAAAA No data
Right 1137949950 16:52774211-52774233 TGTAATCCCAGCTATTCAGAAGG 0: 95
1: 4714
2: 67823
3: 160124
4: 270656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137949946 Original CRISPR TTTTTATTTTTTCGTAGAGA TGG (reversed) Intergenic
No off target data available for this crispr