ID: 1137949954

View in Genome Browser
Species Human (GRCh38)
Location 16:52774218-52774240
Sequence CCAGCTATTCAGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137949946_1137949954 30 Left 1137949946 16:52774165-52774187 CCATCTCTACGAAAAAATAAAAA No data
Right 1137949954 16:52774218-52774240 CCAGCTATTCAGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137949954 Original CRISPR CCAGCTATTCAGAAGGTGGA AGG Intergenic
No off target data available for this crispr