ID: 1137955216

View in Genome Browser
Species Human (GRCh38)
Location 16:52822706-52822728
Sequence AACTGCTTCTAGGAATATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137955213_1137955216 12 Left 1137955213 16:52822671-52822693 CCATTGTTAGGAGTACTGCACAT No data
Right 1137955216 16:52822706-52822728 AACTGCTTCTAGGAATATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137955216 Original CRISPR AACTGCTTCTAGGAATATCA AGG Intergenic
No off target data available for this crispr