ID: 1137955537

View in Genome Browser
Species Human (GRCh38)
Location 16:52825285-52825307
Sequence AGATCACTCTGGATGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137955537_1137955541 30 Left 1137955537 16:52825285-52825307 CCACAAAACATCCAGAGTGATCT No data
Right 1137955541 16:52825338-52825360 CCTTGCTTTAAATATTGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137955537 Original CRISPR AGATCACTCTGGATGTTTTG TGG (reversed) Intergenic
No off target data available for this crispr