ID: 1137960267

View in Genome Browser
Species Human (GRCh38)
Location 16:52875860-52875882
Sequence ATATAGAAAACCCCCTATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137960267_1137960280 28 Left 1137960267 16:52875860-52875882 CCTTAATAGGGGGTTTTCTATAT No data
Right 1137960280 16:52875911-52875933 TGCTGTAGCTGCTGGCCAAGGGG No data
1137960267_1137960273 -6 Left 1137960267 16:52875860-52875882 CCTTAATAGGGGGTTTTCTATAT No data
Right 1137960273 16:52875877-52875899 CTATATAGGGTAAAATTTGGGGG No data
1137960267_1137960271 -8 Left 1137960267 16:52875860-52875882 CCTTAATAGGGGGTTTTCTATAT No data
Right 1137960271 16:52875875-52875897 TTCTATATAGGGTAAAATTTGGG No data
1137960267_1137960278 26 Left 1137960267 16:52875860-52875882 CCTTAATAGGGGGTTTTCTATAT No data
Right 1137960278 16:52875909-52875931 GTTGCTGTAGCTGCTGGCCAAGG No data
1137960267_1137960272 -7 Left 1137960267 16:52875860-52875882 CCTTAATAGGGGGTTTTCTATAT No data
Right 1137960272 16:52875876-52875898 TCTATATAGGGTAAAATTTGGGG No data
1137960267_1137960279 27 Left 1137960267 16:52875860-52875882 CCTTAATAGGGGGTTTTCTATAT No data
Right 1137960279 16:52875910-52875932 TTGCTGTAGCTGCTGGCCAAGGG No data
1137960267_1137960274 4 Left 1137960267 16:52875860-52875882 CCTTAATAGGGGGTTTTCTATAT No data
Right 1137960274 16:52875887-52875909 TAAAATTTGGGGGCCCAGCAAGG No data
1137960267_1137960277 20 Left 1137960267 16:52875860-52875882 CCTTAATAGGGGGTTTTCTATAT No data
Right 1137960277 16:52875903-52875925 AGCAAGGTTGCTGTAGCTGCTGG No data
1137960267_1137960270 -9 Left 1137960267 16:52875860-52875882 CCTTAATAGGGGGTTTTCTATAT No data
Right 1137960270 16:52875874-52875896 TTTCTATATAGGGTAAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137960267 Original CRISPR ATATAGAAAACCCCCTATTA AGG (reversed) Intergenic
No off target data available for this crispr