ID: 1137960272

View in Genome Browser
Species Human (GRCh38)
Location 16:52875876-52875898
Sequence TCTATATAGGGTAAAATTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137960266_1137960272 0 Left 1137960266 16:52875853-52875875 CCTAGAGCCTTAATAGGGGGTTT No data
Right 1137960272 16:52875876-52875898 TCTATATAGGGTAAAATTTGGGG No data
1137960267_1137960272 -7 Left 1137960267 16:52875860-52875882 CCTTAATAGGGGGTTTTCTATAT No data
Right 1137960272 16:52875876-52875898 TCTATATAGGGTAAAATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137960272 Original CRISPR TCTATATAGGGTAAAATTTG GGG Intergenic
No off target data available for this crispr