ID: 1137960620

View in Genome Browser
Species Human (GRCh38)
Location 16:52878361-52878383
Sequence AGGGAAAGACAGCTTTTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137960620_1137960625 4 Left 1137960620 16:52878361-52878383 CCCTACAAAAGCTGTCTTTCCCT No data
Right 1137960625 16:52878388-52878410 TATTAAGCTTTAACATGTTAGGG No data
1137960620_1137960624 3 Left 1137960620 16:52878361-52878383 CCCTACAAAAGCTGTCTTTCCCT No data
Right 1137960624 16:52878387-52878409 TTATTAAGCTTTAACATGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137960620 Original CRISPR AGGGAAAGACAGCTTTTGTA GGG (reversed) Intergenic
No off target data available for this crispr