ID: 1137960621

View in Genome Browser
Species Human (GRCh38)
Location 16:52878362-52878384
Sequence CAGGGAAAGACAGCTTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137960621_1137960624 2 Left 1137960621 16:52878362-52878384 CCTACAAAAGCTGTCTTTCCCTG No data
Right 1137960624 16:52878387-52878409 TTATTAAGCTTTAACATGTTAGG 0: 1
1: 0
2: 0
3: 33
4: 331
1137960621_1137960625 3 Left 1137960621 16:52878362-52878384 CCTACAAAAGCTGTCTTTCCCTG No data
Right 1137960625 16:52878388-52878410 TATTAAGCTTTAACATGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137960621 Original CRISPR CAGGGAAAGACAGCTTTTGT AGG (reversed) Intergenic