ID: 1137960625

View in Genome Browser
Species Human (GRCh38)
Location 16:52878388-52878410
Sequence TATTAAGCTTTAACATGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137960621_1137960625 3 Left 1137960621 16:52878362-52878384 CCTACAAAAGCTGTCTTTCCCTG No data
Right 1137960625 16:52878388-52878410 TATTAAGCTTTAACATGTTAGGG No data
1137960620_1137960625 4 Left 1137960620 16:52878361-52878383 CCCTACAAAAGCTGTCTTTCCCT No data
Right 1137960625 16:52878388-52878410 TATTAAGCTTTAACATGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137960625 Original CRISPR TATTAAGCTTTAACATGTTA GGG Intergenic
No off target data available for this crispr