ID: 1137963552

View in Genome Browser
Species Human (GRCh38)
Location 16:52909298-52909320
Sequence CCTCATTGATTGTAGCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137963544_1137963552 15 Left 1137963544 16:52909260-52909282 CCCTTGGCTTTGGATCCTCTGTG No data
Right 1137963552 16:52909298-52909320 CCTCATTGATTGTAGCTTGAGGG No data
1137963548_1137963552 0 Left 1137963548 16:52909275-52909297 CCTCTGTGTTGTTATCACAGGGG No data
Right 1137963552 16:52909298-52909320 CCTCATTGATTGTAGCTTGAGGG No data
1137963545_1137963552 14 Left 1137963545 16:52909261-52909283 CCTTGGCTTTGGATCCTCTGTGT No data
Right 1137963552 16:52909298-52909320 CCTCATTGATTGTAGCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137963552 Original CRISPR CCTCATTGATTGTAGCTTGA GGG Intergenic
No off target data available for this crispr