ID: 1137965559

View in Genome Browser
Species Human (GRCh38)
Location 16:52929179-52929201
Sequence CGTCATCGAAACAAGCCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137965556_1137965559 -5 Left 1137965556 16:52929161-52929183 CCACAAAGAGATCGTGGGCGTCA No data
Right 1137965559 16:52929179-52929201 CGTCATCGAAACAAGCCTTGGGG No data
1137965551_1137965559 8 Left 1137965551 16:52929148-52929170 CCAGACTACCCAACCACAAAGAG No data
Right 1137965559 16:52929179-52929201 CGTCATCGAAACAAGCCTTGGGG No data
1137965553_1137965559 0 Left 1137965553 16:52929156-52929178 CCCAACCACAAAGAGATCGTGGG No data
Right 1137965559 16:52929179-52929201 CGTCATCGAAACAAGCCTTGGGG No data
1137965555_1137965559 -1 Left 1137965555 16:52929157-52929179 CCAACCACAAAGAGATCGTGGGC No data
Right 1137965559 16:52929179-52929201 CGTCATCGAAACAAGCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137965559 Original CRISPR CGTCATCGAAACAAGCCTTG GGG Intergenic
No off target data available for this crispr