ID: 1137966609

View in Genome Browser
Species Human (GRCh38)
Location 16:52940442-52940464
Sequence TGTTAGGAACAGGACCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137966602_1137966609 26 Left 1137966602 16:52940393-52940415 CCACTTGCCTGGACTGCAAGGCC No data
Right 1137966609 16:52940442-52940464 TGTTAGGAACAGGACCTGGGAGG No data
1137966603_1137966609 19 Left 1137966603 16:52940400-52940422 CCTGGACTGCAAGGCCTGAGATG No data
Right 1137966609 16:52940442-52940464 TGTTAGGAACAGGACCTGGGAGG No data
1137966604_1137966609 5 Left 1137966604 16:52940414-52940436 CCTGAGATGCAGATACAAAACAG No data
Right 1137966609 16:52940442-52940464 TGTTAGGAACAGGACCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137966609 Original CRISPR TGTTAGGAACAGGACCTGGG AGG Intergenic
No off target data available for this crispr