ID: 1137968645

View in Genome Browser
Species Human (GRCh38)
Location 16:52961796-52961818
Sequence CTCTAACTGGAAGAGCACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137968645_1137968653 9 Left 1137968645 16:52961796-52961818 CCCTTGTGCTCTTCCAGTTAGAG No data
Right 1137968653 16:52961828-52961850 GGGAGGCACCAGCAAGAGATGGG No data
1137968645_1137968654 13 Left 1137968645 16:52961796-52961818 CCCTTGTGCTCTTCCAGTTAGAG No data
Right 1137968654 16:52961832-52961854 GGCACCAGCAAGAGATGGGATGG No data
1137968645_1137968650 -8 Left 1137968645 16:52961796-52961818 CCCTTGTGCTCTTCCAGTTAGAG No data
Right 1137968650 16:52961811-52961833 AGTTAGAGACAGCCAATGGGAGG No data
1137968645_1137968656 20 Left 1137968645 16:52961796-52961818 CCCTTGTGCTCTTCCAGTTAGAG No data
Right 1137968656 16:52961839-52961861 GCAAGAGATGGGATGGTGAGAGG No data
1137968645_1137968652 8 Left 1137968645 16:52961796-52961818 CCCTTGTGCTCTTCCAGTTAGAG No data
Right 1137968652 16:52961827-52961849 TGGGAGGCACCAGCAAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137968645 Original CRISPR CTCTAACTGGAAGAGCACAA GGG (reversed) Intergenic
No off target data available for this crispr