ID: 1137973059

View in Genome Browser
Species Human (GRCh38)
Location 16:53004830-53004852
Sequence CTCTAGAAGGGGGCTTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137973052_1137973059 -9 Left 1137973052 16:53004816-53004838 CCAGCTGTTTTGCCCTCTAGAAG No data
Right 1137973059 16:53004830-53004852 CTCTAGAAGGGGGCTTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137973059 Original CRISPR CTCTAGAAGGGGGCTTTGAG AGG Intergenic
No off target data available for this crispr