ID: 1137976756

View in Genome Browser
Species Human (GRCh38)
Location 16:53038636-53038658
Sequence TGTGTCAAGACTGGGCGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137976756_1137976768 25 Left 1137976756 16:53038636-53038658 CCACTGCGCCCAGTCTTGACACA No data
Right 1137976768 16:53038684-53038706 GCACCCCCTGTACAACAACGGGG No data
1137976756_1137976767 24 Left 1137976756 16:53038636-53038658 CCACTGCGCCCAGTCTTGACACA No data
Right 1137976767 16:53038683-53038705 TGCACCCCCTGTACAACAACGGG No data
1137976756_1137976766 23 Left 1137976756 16:53038636-53038658 CCACTGCGCCCAGTCTTGACACA No data
Right 1137976766 16:53038682-53038704 CTGCACCCCCTGTACAACAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137976756 Original CRISPR TGTGTCAAGACTGGGCGCAG TGG (reversed) Intergenic
No off target data available for this crispr