ID: 1137976757

View in Genome Browser
Species Human (GRCh38)
Location 16:53038644-53038666
Sequence TAATTTTATGTGTCAAGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137976757_1137976773 29 Left 1137976757 16:53038644-53038666 CCCAGTCTTGACACATAAAATTA No data
Right 1137976773 16:53038696-53038718 CAACAACGGGGTTTTATTGTAGG No data
1137976757_1137976766 15 Left 1137976757 16:53038644-53038666 CCCAGTCTTGACACATAAAATTA No data
Right 1137976766 16:53038682-53038704 CTGCACCCCCTGTACAACAACGG No data
1137976757_1137976768 17 Left 1137976757 16:53038644-53038666 CCCAGTCTTGACACATAAAATTA No data
Right 1137976768 16:53038684-53038706 GCACCCCCTGTACAACAACGGGG No data
1137976757_1137976767 16 Left 1137976757 16:53038644-53038666 CCCAGTCTTGACACATAAAATTA No data
Right 1137976767 16:53038683-53038705 TGCACCCCCTGTACAACAACGGG No data
1137976757_1137976774 30 Left 1137976757 16:53038644-53038666 CCCAGTCTTGACACATAAAATTA No data
Right 1137976774 16:53038697-53038719 AACAACGGGGTTTTATTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137976757 Original CRISPR TAATTTTATGTGTCAAGACT GGG (reversed) Intergenic
No off target data available for this crispr