ID: 1137976759

View in Genome Browser
Species Human (GRCh38)
Location 16:53038668-53038690
Sequence GGGGTGCAGGGGGGGTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137976759_1137976774 6 Left 1137976759 16:53038668-53038690 CCATCACACCCCCCCTGCACCCC No data
Right 1137976774 16:53038697-53038719 AACAACGGGGTTTTATTGTAGGG No data
1137976759_1137976776 18 Left 1137976759 16:53038668-53038690 CCATCACACCCCCCCTGCACCCC No data
Right 1137976776 16:53038709-53038731 TTATTGTAGGGGAGAGAGATTGG No data
1137976759_1137976777 19 Left 1137976759 16:53038668-53038690 CCATCACACCCCCCCTGCACCCC No data
Right 1137976777 16:53038710-53038732 TATTGTAGGGGAGAGAGATTGGG No data
1137976759_1137976773 5 Left 1137976759 16:53038668-53038690 CCATCACACCCCCCCTGCACCCC No data
Right 1137976773 16:53038696-53038718 CAACAACGGGGTTTTATTGTAGG No data
1137976759_1137976768 -7 Left 1137976759 16:53038668-53038690 CCATCACACCCCCCCTGCACCCC No data
Right 1137976768 16:53038684-53038706 GCACCCCCTGTACAACAACGGGG No data
1137976759_1137976766 -9 Left 1137976759 16:53038668-53038690 CCATCACACCCCCCCTGCACCCC No data
Right 1137976766 16:53038682-53038704 CTGCACCCCCTGTACAACAACGG No data
1137976759_1137976767 -8 Left 1137976759 16:53038668-53038690 CCATCACACCCCCCCTGCACCCC No data
Right 1137976767 16:53038683-53038705 TGCACCCCCTGTACAACAACGGG No data
1137976759_1137976775 7 Left 1137976759 16:53038668-53038690 CCATCACACCCCCCCTGCACCCC No data
Right 1137976775 16:53038698-53038720 ACAACGGGGTTTTATTGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137976759 Original CRISPR GGGGTGCAGGGGGGGTGTGA TGG (reversed) Intergenic