ID: 1137976760

View in Genome Browser
Species Human (GRCh38)
Location 16:53038676-53038698
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137976760_1137976777 11 Left 1137976760 16:53038676-53038698 CCCCCCCTGCACCCCCTGTACAA No data
Right 1137976777 16:53038710-53038732 TATTGTAGGGGAGAGAGATTGGG No data
1137976760_1137976773 -3 Left 1137976760 16:53038676-53038698 CCCCCCCTGCACCCCCTGTACAA No data
Right 1137976773 16:53038696-53038718 CAACAACGGGGTTTTATTGTAGG No data
1137976760_1137976776 10 Left 1137976760 16:53038676-53038698 CCCCCCCTGCACCCCCTGTACAA No data
Right 1137976776 16:53038709-53038731 TTATTGTAGGGGAGAGAGATTGG 0: 1
1: 0
2: 6
3: 57
4: 364
1137976760_1137976775 -1 Left 1137976760 16:53038676-53038698 CCCCCCCTGCACCCCCTGTACAA No data
Right 1137976775 16:53038698-53038720 ACAACGGGGTTTTATTGTAGGGG No data
1137976760_1137976774 -2 Left 1137976760 16:53038676-53038698 CCCCCCCTGCACCCCCTGTACAA No data
Right 1137976774 16:53038697-53038719 AACAACGGGGTTTTATTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137976760 Original CRISPR TTGTACAGGGGGTGCAGGGG GGG (reversed) Intergenic