ID: 1137976764

View in Genome Browser
Species Human (GRCh38)
Location 16:53038680-53038702
Sequence GTTGTTGTACAGGGGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137976764_1137976778 29 Left 1137976764 16:53038680-53038702 CCCTGCACCCCCTGTACAACAAC No data
Right 1137976778 16:53038732-53038754 GCTTAATTCAGAATACAACAAGG No data
1137976764_1137976773 -7 Left 1137976764 16:53038680-53038702 CCCTGCACCCCCTGTACAACAAC No data
Right 1137976773 16:53038696-53038718 CAACAACGGGGTTTTATTGTAGG No data
1137976764_1137976775 -5 Left 1137976764 16:53038680-53038702 CCCTGCACCCCCTGTACAACAAC No data
Right 1137976775 16:53038698-53038720 ACAACGGGGTTTTATTGTAGGGG No data
1137976764_1137976776 6 Left 1137976764 16:53038680-53038702 CCCTGCACCCCCTGTACAACAAC No data
Right 1137976776 16:53038709-53038731 TTATTGTAGGGGAGAGAGATTGG No data
1137976764_1137976774 -6 Left 1137976764 16:53038680-53038702 CCCTGCACCCCCTGTACAACAAC No data
Right 1137976774 16:53038697-53038719 AACAACGGGGTTTTATTGTAGGG No data
1137976764_1137976777 7 Left 1137976764 16:53038680-53038702 CCCTGCACCCCCTGTACAACAAC No data
Right 1137976777 16:53038710-53038732 TATTGTAGGGGAGAGAGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137976764 Original CRISPR GTTGTTGTACAGGGGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr