ID: 1137976767

View in Genome Browser
Species Human (GRCh38)
Location 16:53038683-53038705
Sequence TGCACCCCCTGTACAACAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137976758_1137976767 15 Left 1137976758 16:53038645-53038667 CCAGTCTTGACACATAAAATTAA No data
Right 1137976767 16:53038683-53038705 TGCACCCCCTGTACAACAACGGG No data
1137976757_1137976767 16 Left 1137976757 16:53038644-53038666 CCCAGTCTTGACACATAAAATTA No data
Right 1137976767 16:53038683-53038705 TGCACCCCCTGTACAACAACGGG No data
1137976759_1137976767 -8 Left 1137976759 16:53038668-53038690 CCATCACACCCCCCCTGCACCCC No data
Right 1137976767 16:53038683-53038705 TGCACCCCCTGTACAACAACGGG No data
1137976756_1137976767 24 Left 1137976756 16:53038636-53038658 CCACTGCGCCCAGTCTTGACACA No data
Right 1137976767 16:53038683-53038705 TGCACCCCCTGTACAACAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137976767 Original CRISPR TGCACCCCCTGTACAACAAC GGG Intergenic
No off target data available for this crispr