ID: 1137976769

View in Genome Browser
Species Human (GRCh38)
Location 16:53038687-53038709
Sequence AAACCCCGTTGTTGTACAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137976769_1137976776 -1 Left 1137976769 16:53038687-53038709 CCCCCTGTACAACAACGGGGTTT No data
Right 1137976776 16:53038709-53038731 TTATTGTAGGGGAGAGAGATTGG No data
1137976769_1137976777 0 Left 1137976769 16:53038687-53038709 CCCCCTGTACAACAACGGGGTTT No data
Right 1137976777 16:53038710-53038732 TATTGTAGGGGAGAGAGATTGGG No data
1137976769_1137976778 22 Left 1137976769 16:53038687-53038709 CCCCCTGTACAACAACGGGGTTT No data
Right 1137976778 16:53038732-53038754 GCTTAATTCAGAATACAACAAGG No data
1137976769_1137976779 30 Left 1137976769 16:53038687-53038709 CCCCCTGTACAACAACGGGGTTT No data
Right 1137976779 16:53038740-53038762 CAGAATACAACAAGGAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137976769 Original CRISPR AAACCCCGTTGTTGTACAGG GGG (reversed) Intergenic