ID: 1137976770

View in Genome Browser
Species Human (GRCh38)
Location 16:53038688-53038710
Sequence AAAACCCCGTTGTTGTACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137976770_1137976778 21 Left 1137976770 16:53038688-53038710 CCCCTGTACAACAACGGGGTTTT No data
Right 1137976778 16:53038732-53038754 GCTTAATTCAGAATACAACAAGG No data
1137976770_1137976779 29 Left 1137976770 16:53038688-53038710 CCCCTGTACAACAACGGGGTTTT No data
Right 1137976779 16:53038740-53038762 CAGAATACAACAAGGAAATGTGG No data
1137976770_1137976777 -1 Left 1137976770 16:53038688-53038710 CCCCTGTACAACAACGGGGTTTT No data
Right 1137976777 16:53038710-53038732 TATTGTAGGGGAGAGAGATTGGG No data
1137976770_1137976780 30 Left 1137976770 16:53038688-53038710 CCCCTGTACAACAACGGGGTTTT No data
Right 1137976780 16:53038741-53038763 AGAATACAACAAGGAAATGTGGG No data
1137976770_1137976776 -2 Left 1137976770 16:53038688-53038710 CCCCTGTACAACAACGGGGTTTT No data
Right 1137976776 16:53038709-53038731 TTATTGTAGGGGAGAGAGATTGG 0: 1
1: 0
2: 6
3: 57
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137976770 Original CRISPR AAAACCCCGTTGTTGTACAG GGG (reversed) Intergenic