ID: 1137976771

View in Genome Browser
Species Human (GRCh38)
Location 16:53038689-53038711
Sequence TAAAACCCCGTTGTTGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137976771_1137976779 28 Left 1137976771 16:53038689-53038711 CCCTGTACAACAACGGGGTTTTA No data
Right 1137976779 16:53038740-53038762 CAGAATACAACAAGGAAATGTGG No data
1137976771_1137976780 29 Left 1137976771 16:53038689-53038711 CCCTGTACAACAACGGGGTTTTA No data
Right 1137976780 16:53038741-53038763 AGAATACAACAAGGAAATGTGGG No data
1137976771_1137976776 -3 Left 1137976771 16:53038689-53038711 CCCTGTACAACAACGGGGTTTTA No data
Right 1137976776 16:53038709-53038731 TTATTGTAGGGGAGAGAGATTGG No data
1137976771_1137976777 -2 Left 1137976771 16:53038689-53038711 CCCTGTACAACAACGGGGTTTTA No data
Right 1137976777 16:53038710-53038732 TATTGTAGGGGAGAGAGATTGGG No data
1137976771_1137976778 20 Left 1137976771 16:53038689-53038711 CCCTGTACAACAACGGGGTTTTA No data
Right 1137976778 16:53038732-53038754 GCTTAATTCAGAATACAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137976771 Original CRISPR TAAAACCCCGTTGTTGTACA GGG (reversed) Intergenic