ID: 1137976772

View in Genome Browser
Species Human (GRCh38)
Location 16:53038690-53038712
Sequence ATAAAACCCCGTTGTTGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137976772_1137976777 -3 Left 1137976772 16:53038690-53038712 CCTGTACAACAACGGGGTTTTAT No data
Right 1137976777 16:53038710-53038732 TATTGTAGGGGAGAGAGATTGGG No data
1137976772_1137976779 27 Left 1137976772 16:53038690-53038712 CCTGTACAACAACGGGGTTTTAT No data
Right 1137976779 16:53038740-53038762 CAGAATACAACAAGGAAATGTGG No data
1137976772_1137976776 -4 Left 1137976772 16:53038690-53038712 CCTGTACAACAACGGGGTTTTAT No data
Right 1137976776 16:53038709-53038731 TTATTGTAGGGGAGAGAGATTGG 0: 1
1: 0
2: 6
3: 57
4: 364
1137976772_1137976780 28 Left 1137976772 16:53038690-53038712 CCTGTACAACAACGGGGTTTTAT No data
Right 1137976780 16:53038741-53038763 AGAATACAACAAGGAAATGTGGG No data
1137976772_1137976778 19 Left 1137976772 16:53038690-53038712 CCTGTACAACAACGGGGTTTTAT No data
Right 1137976778 16:53038732-53038754 GCTTAATTCAGAATACAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137976772 Original CRISPR ATAAAACCCCGTTGTTGTAC AGG (reversed) Intergenic