ID: 1137976774

View in Genome Browser
Species Human (GRCh38)
Location 16:53038697-53038719
Sequence AACAACGGGGTTTTATTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137976759_1137976774 6 Left 1137976759 16:53038668-53038690 CCATCACACCCCCCCTGCACCCC No data
Right 1137976774 16:53038697-53038719 AACAACGGGGTTTTATTGTAGGG No data
1137976757_1137976774 30 Left 1137976757 16:53038644-53038666 CCCAGTCTTGACACATAAAATTA No data
Right 1137976774 16:53038697-53038719 AACAACGGGGTTTTATTGTAGGG No data
1137976764_1137976774 -6 Left 1137976764 16:53038680-53038702 CCCTGCACCCCCTGTACAACAAC No data
Right 1137976774 16:53038697-53038719 AACAACGGGGTTTTATTGTAGGG No data
1137976765_1137976774 -7 Left 1137976765 16:53038681-53038703 CCTGCACCCCCTGTACAACAACG No data
Right 1137976774 16:53038697-53038719 AACAACGGGGTTTTATTGTAGGG No data
1137976763_1137976774 -5 Left 1137976763 16:53038679-53038701 CCCCTGCACCCCCTGTACAACAA No data
Right 1137976774 16:53038697-53038719 AACAACGGGGTTTTATTGTAGGG No data
1137976758_1137976774 29 Left 1137976758 16:53038645-53038667 CCAGTCTTGACACATAAAATTAA No data
Right 1137976774 16:53038697-53038719 AACAACGGGGTTTTATTGTAGGG No data
1137976762_1137976774 -4 Left 1137976762 16:53038678-53038700 CCCCCTGCACCCCCTGTACAACA No data
Right 1137976774 16:53038697-53038719 AACAACGGGGTTTTATTGTAGGG No data
1137976761_1137976774 -3 Left 1137976761 16:53038677-53038699 CCCCCCTGCACCCCCTGTACAAC No data
Right 1137976774 16:53038697-53038719 AACAACGGGGTTTTATTGTAGGG No data
1137976760_1137976774 -2 Left 1137976760 16:53038676-53038698 CCCCCCCTGCACCCCCTGTACAA No data
Right 1137976774 16:53038697-53038719 AACAACGGGGTTTTATTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137976774 Original CRISPR AACAACGGGGTTTTATTGTA GGG Intergenic
No off target data available for this crispr