ID: 1137976777

View in Genome Browser
Species Human (GRCh38)
Location 16:53038710-53038732
Sequence TATTGTAGGGGAGAGAGATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137976761_1137976777 10 Left 1137976761 16:53038677-53038699 CCCCCCTGCACCCCCTGTACAAC No data
Right 1137976777 16:53038710-53038732 TATTGTAGGGGAGAGAGATTGGG No data
1137976763_1137976777 8 Left 1137976763 16:53038679-53038701 CCCCTGCACCCCCTGTACAACAA No data
Right 1137976777 16:53038710-53038732 TATTGTAGGGGAGAGAGATTGGG No data
1137976769_1137976777 0 Left 1137976769 16:53038687-53038709 CCCCCTGTACAACAACGGGGTTT No data
Right 1137976777 16:53038710-53038732 TATTGTAGGGGAGAGAGATTGGG No data
1137976771_1137976777 -2 Left 1137976771 16:53038689-53038711 CCCTGTACAACAACGGGGTTTTA No data
Right 1137976777 16:53038710-53038732 TATTGTAGGGGAGAGAGATTGGG No data
1137976764_1137976777 7 Left 1137976764 16:53038680-53038702 CCCTGCACCCCCTGTACAACAAC No data
Right 1137976777 16:53038710-53038732 TATTGTAGGGGAGAGAGATTGGG No data
1137976772_1137976777 -3 Left 1137976772 16:53038690-53038712 CCTGTACAACAACGGGGTTTTAT No data
Right 1137976777 16:53038710-53038732 TATTGTAGGGGAGAGAGATTGGG No data
1137976770_1137976777 -1 Left 1137976770 16:53038688-53038710 CCCCTGTACAACAACGGGGTTTT No data
Right 1137976777 16:53038710-53038732 TATTGTAGGGGAGAGAGATTGGG No data
1137976759_1137976777 19 Left 1137976759 16:53038668-53038690 CCATCACACCCCCCCTGCACCCC No data
Right 1137976777 16:53038710-53038732 TATTGTAGGGGAGAGAGATTGGG No data
1137976760_1137976777 11 Left 1137976760 16:53038676-53038698 CCCCCCCTGCACCCCCTGTACAA No data
Right 1137976777 16:53038710-53038732 TATTGTAGGGGAGAGAGATTGGG No data
1137976765_1137976777 6 Left 1137976765 16:53038681-53038703 CCTGCACCCCCTGTACAACAACG No data
Right 1137976777 16:53038710-53038732 TATTGTAGGGGAGAGAGATTGGG No data
1137976762_1137976777 9 Left 1137976762 16:53038678-53038700 CCCCCTGCACCCCCTGTACAACA No data
Right 1137976777 16:53038710-53038732 TATTGTAGGGGAGAGAGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137976777 Original CRISPR TATTGTAGGGGAGAGAGATT GGG Intergenic
No off target data available for this crispr