ID: 1137976778

View in Genome Browser
Species Human (GRCh38)
Location 16:53038732-53038754
Sequence GCTTAATTCAGAATACAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137976765_1137976778 28 Left 1137976765 16:53038681-53038703 CCTGCACCCCCTGTACAACAACG No data
Right 1137976778 16:53038732-53038754 GCTTAATTCAGAATACAACAAGG No data
1137976764_1137976778 29 Left 1137976764 16:53038680-53038702 CCCTGCACCCCCTGTACAACAAC No data
Right 1137976778 16:53038732-53038754 GCTTAATTCAGAATACAACAAGG No data
1137976769_1137976778 22 Left 1137976769 16:53038687-53038709 CCCCCTGTACAACAACGGGGTTT No data
Right 1137976778 16:53038732-53038754 GCTTAATTCAGAATACAACAAGG No data
1137976763_1137976778 30 Left 1137976763 16:53038679-53038701 CCCCTGCACCCCCTGTACAACAA No data
Right 1137976778 16:53038732-53038754 GCTTAATTCAGAATACAACAAGG No data
1137976772_1137976778 19 Left 1137976772 16:53038690-53038712 CCTGTACAACAACGGGGTTTTAT No data
Right 1137976778 16:53038732-53038754 GCTTAATTCAGAATACAACAAGG No data
1137976770_1137976778 21 Left 1137976770 16:53038688-53038710 CCCCTGTACAACAACGGGGTTTT No data
Right 1137976778 16:53038732-53038754 GCTTAATTCAGAATACAACAAGG No data
1137976771_1137976778 20 Left 1137976771 16:53038689-53038711 CCCTGTACAACAACGGGGTTTTA No data
Right 1137976778 16:53038732-53038754 GCTTAATTCAGAATACAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137976778 Original CRISPR GCTTAATTCAGAATACAACA AGG Intergenic
No off target data available for this crispr