ID: 1137978169

View in Genome Browser
Species Human (GRCh38)
Location 16:53048288-53048310
Sequence CTGCAGCCACTGTAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137978169_1137978176 -1 Left 1137978169 16:53048288-53048310 CCCAGCTACTACAGTGGCTGCAG No data
Right 1137978176 16:53048310-53048332 GTGGGAGGTCACTGGAATCTGGG No data
1137978169_1137978175 -2 Left 1137978169 16:53048288-53048310 CCCAGCTACTACAGTGGCTGCAG No data
Right 1137978175 16:53048309-53048331 AGTGGGAGGTCACTGGAATCTGG No data
1137978169_1137978178 5 Left 1137978169 16:53048288-53048310 CCCAGCTACTACAGTGGCTGCAG No data
Right 1137978178 16:53048316-53048338 GGTCACTGGAATCTGGGAGGTGG No data
1137978169_1137978174 -9 Left 1137978169 16:53048288-53048310 CCCAGCTACTACAGTGGCTGCAG No data
Right 1137978174 16:53048302-53048324 TGGCTGCAGTGGGAGGTCACTGG No data
1137978169_1137978177 2 Left 1137978169 16:53048288-53048310 CCCAGCTACTACAGTGGCTGCAG No data
Right 1137978177 16:53048313-53048335 GGAGGTCACTGGAATCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137978169 Original CRISPR CTGCAGCCACTGTAGTAGCT GGG (reversed) Intergenic
No off target data available for this crispr