ID: 1137982975

View in Genome Browser
Species Human (GRCh38)
Location 16:53085421-53085443
Sequence TCCTCCCCAAGGCAGATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137982975_1137982977 -8 Left 1137982975 16:53085421-53085443 CCTGACATCTGCCTTGGGGAGGA 0: 1
1: 0
2: 4
3: 14
4: 189
Right 1137982977 16:53085436-53085458 GGGGAGGACCTTCTATCCCCTGG 0: 1
1: 0
2: 2
3: 5
4: 119
1137982975_1137982978 -7 Left 1137982975 16:53085421-53085443 CCTGACATCTGCCTTGGGGAGGA 0: 1
1: 0
2: 4
3: 14
4: 189
Right 1137982978 16:53085437-53085459 GGGAGGACCTTCTATCCCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 115
1137982975_1137982980 0 Left 1137982975 16:53085421-53085443 CCTGACATCTGCCTTGGGGAGGA 0: 1
1: 0
2: 4
3: 14
4: 189
Right 1137982980 16:53085444-53085466 CCTTCTATCCCCTGGGCTCCTGG 0: 1
1: 0
2: 2
3: 41
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137982975 Original CRISPR TCCTCCCCAAGGCAGATGTC AGG (reversed) Intronic
900938989 1:5785527-5785549 TCCTCCCCAACCAGGATGTCAGG + Intergenic
905034998 1:34912450-34912472 TCCTTCCCCAGGAAGTTGTCTGG + Intronic
905911408 1:41657480-41657502 TCCTCCCAAAGGCTGGTGTTTGG + Intronic
906265337 1:44424648-44424670 TCCTCCCCAAGACAGGAGACTGG - Intronic
910253350 1:85221258-85221280 TCTTCCCAAAGGGAGATTTCTGG - Intergenic
913518716 1:119625868-119625890 TCCTCACCTGTGCAGATGTCGGG + Exonic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
915836434 1:159180140-159180162 TTCTCCCCAAAGCAGAATTCAGG - Intronic
917488148 1:175474105-175474127 TCCTCCCAAAGACACATCTCTGG - Intronic
919400529 1:197111012-197111034 TCTTTCCCAAGGCTGATATCCGG - Intronic
920236973 1:204514271-204514293 TCCTCCACTAGACAGATTTCAGG + Intergenic
920296486 1:204960453-204960475 TCCTCCCTAAGGCAGACACCAGG + Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
920572872 1:207031153-207031175 TCCAGCCCAAGGCACATTTCTGG - Intronic
1064263334 10:13803932-13803954 TCCTTCCCAATGCAAATGACCGG - Intronic
1064459275 10:15517944-15517966 TCCACCCCAAAGCAGCTGACAGG - Intronic
1065599064 10:27350144-27350166 TCCTGCCCAGGCCAGATGCCCGG - Intergenic
1066018797 10:31275683-31275705 TCCACCCCAAGGTAGCTTTCAGG - Intergenic
1067043457 10:42970644-42970666 TCCACCCCATAGCAGAGGTCAGG + Intergenic
1071298036 10:84236848-84236870 TCCTGCCCAAGGCACCTGCCTGG - Intronic
1073199657 10:101725003-101725025 TCCTCCCCAGTGCACAGGTCAGG + Intergenic
1073466722 10:103698499-103698521 TCACCCCCAAGTCAGCTGTCTGG - Intronic
1074500293 10:114017674-114017696 TTCTCCCAAAAGCAGATTTCAGG + Intergenic
1075288654 10:121209248-121209270 TCATCCCTATGGCAGATGTTTGG - Intergenic
1076889353 10:133276330-133276352 TCCTCCCCCAGGCAGGAGACGGG + Intronic
1077438746 11:2558535-2558557 TCCCACCCCAGGCAGGTGTCAGG + Intronic
1078007830 11:7545885-7545907 TCCTCCCCAAGGTAGGAGTCGGG - Intronic
1078269858 11:9785215-9785237 TCCTCCCCCATGCTGCTGTCTGG + Exonic
1078413810 11:11149064-11149086 TGCTGCCCAAGGCAGCTGCCTGG + Intergenic
1078604945 11:12766938-12766960 TCCTCCCCAAGGCAGCTGCCTGG - Intronic
1078851821 11:15171217-15171239 TGCTCCCCAAGGAAGAGCTCTGG - Intronic
1078989550 11:16632782-16632804 TCCACGCCTAGGCAGATCTCCGG - Intronic
1079136761 11:17779810-17779832 TTCCCCCCAAGTGAGATGTCAGG + Intronic
1081569615 11:44281497-44281519 TCCCCCACAAAGCAGATGTTTGG - Intronic
1083414646 11:62517660-62517682 CCTTCACCAAGGCTGATGTCTGG + Exonic
1084189413 11:67492200-67492222 TCTTGCCCAAGGCAGCTCTCGGG + Exonic
1084316887 11:68350681-68350703 TCCTCACCAAGGCTGGTGTTTGG + Intronic
1085047106 11:73360026-73360048 TCTTCCCTCAGGCAAATGTCAGG - Intronic
1087008738 11:93493865-93493887 TGCTGCCCAAGCCAGAAGTCTGG + Intronic
1090187759 11:124749416-124749438 ATCTCCCCAAGGCAGATGGGTGG + Intronic
1091041406 11:132284758-132284780 TTCTCCCCAAGGCCACTGTCGGG - Intronic
1095233978 12:39775478-39775500 CCCTCCCCAAGGCAGAGTTCAGG - Intronic
1095970244 12:47896832-47896854 TCCTGCCCCTGGCAGAAGTCCGG + Intronic
1096179552 12:49543054-49543076 TCCTCCCCTAAGCAGCTGTGTGG + Intronic
1096779880 12:53985659-53985681 TGCTCCCCAAGGCAGGACTCCGG - Exonic
1102220078 12:111188366-111188388 TCCTGCCCAATGCTGATGGCAGG - Intronic
1104455523 12:128908560-128908582 TCCTACCCAAGGCGGAAGACTGG + Intronic
1106315617 13:28590802-28590824 TCCTCCTCCAGGAAGATGTCTGG - Intergenic
1108393289 13:49969318-49969340 TCTTCCCCAAAGAAGATGTATGG + Intergenic
1111590230 13:90336967-90336989 TCCTCCCCAGAGCAGCTCTCAGG + Intergenic
1117912012 14:60646036-60646058 TCCTTCCCAATGCAGAGATCAGG - Exonic
1118594443 14:67424913-67424935 TCCTCCCCAAGGCTGGTCCCTGG + Intergenic
1118720096 14:68587722-68587744 TGCTACCCAAGGCTGATGTTGGG + Intronic
1119163161 14:72470311-72470333 TCCTCCCAAAGGTAGAACTCTGG + Intronic
1119966399 14:78921022-78921044 TTCTCTCCAACCCAGATGTCAGG + Intronic
1122415906 14:101549345-101549367 TCATCCCCCAGGCAGGTGCCGGG - Intergenic
1123056938 14:105575161-105575183 CCCTCCCCCAGGCAGGTGTGAGG + Intergenic
1123081272 14:105696624-105696646 CCCTCCCCCAGGCAGGTGTGAGG - Intergenic
1124997830 15:34741012-34741034 TCCTCCCAAAAGCAAATTTCAGG + Intergenic
1128309374 15:66620921-66620943 TCCTTCCCAGGGCAGCTGTGGGG - Intronic
1129296933 15:74604773-74604795 CCCTCCCCAAGCCTGAAGTCAGG - Intronic
1129471781 15:75760041-75760063 TCCTTCCCAGGGCAGTTGTGAGG + Intergenic
1130755647 15:86760291-86760313 TTCTCCCCAAGGCTGATTTATGG - Intronic
1131224214 15:90610788-90610810 TCCTCCACATGCCCGATGTCAGG - Intronic
1132237376 15:100232340-100232362 TTCCCCTCAAGGCAGATGTGAGG + Intronic
1133984781 16:10660287-10660309 GCCTGCCCAAGGCAGGTGGCAGG + Intronic
1136343278 16:29659034-29659056 TGTTCCCCAAGCCAGATGTTGGG - Intergenic
1136525748 16:30829018-30829040 TCCTCCCCAATTCAGATCTCAGG + Intergenic
1137982975 16:53085421-53085443 TCCTCCCCAAGGCAGATGTCAGG - Intronic
1138249209 16:55489483-55489505 TCCTGCACAAGGCTGTTGTCAGG + Intronic
1138439951 16:57028226-57028248 TCCTACACAAGGCAGATTCCTGG + Intronic
1138975482 16:62202103-62202125 TCCTCCCCACTGCAAATGGCGGG + Intergenic
1139430432 16:66908262-66908284 TCCACCCCAGGGCAGATGGAGGG + Exonic
1139709075 16:68762268-68762290 TCATCCCCAAGGCCTGTGTCGGG + Intronic
1140723210 16:77789094-77789116 GCCTCCCCAAGCCAGATCTAGGG + Intronic
1141022884 16:80514178-80514200 TCTTACCCAAGGCAGCTGTTAGG - Intergenic
1144125105 17:12196032-12196054 TTCTTCCCCAGGCAGATTTCAGG + Intergenic
1146124454 17:30220786-30220808 TCCTCCCCCAGCCAGAAGTGAGG - Intronic
1146594071 17:34154811-34154833 TCCTCCCTAAGGCAGCTATGGGG + Intronic
1148353435 17:46957837-46957859 TCCTCCTCCATGGAGATGTCTGG - Intronic
1150144746 17:62758996-62759018 TCCTGCCCCAGGCAGAAGACTGG + Intronic
1150147539 17:62781689-62781711 CCCACCTCAAGGCAGTTGTCTGG + Intronic
1150315721 17:64167080-64167102 TCCCACCAAAGGCAGATGGCTGG - Intronic
1152595549 17:81236083-81236105 TCCACCCCATGGAAGATCTCAGG + Intronic
1153091301 18:1346996-1347018 TCCTCTCCAAGGCAGCTATTAGG + Intergenic
1155480398 18:26280239-26280261 TCTTTGCCAAGGCCGATGTCAGG - Intronic
1158404664 18:57150869-57150891 TCCTCCCCCACTCAGATCTCTGG + Intergenic
1158983386 18:62787955-62787977 TTCTCCCAAAGGCAGCAGTCTGG - Intronic
1160019257 18:75167744-75167766 CCCTCCCCAAGGCAGCTAACTGG - Intergenic
1160044669 18:75375711-75375733 TCTTTACCAAGCCAGATGTCAGG + Intergenic
1162472852 19:10882836-10882858 TGCTCCCCAAGACTGAGGTCGGG - Intronic
1163320193 19:16570273-16570295 TGCTCCCCCAGGGTGATGTCAGG - Intronic
1164784868 19:30922180-30922202 TCCTCCCCATGCCAGCTTTCAGG - Intergenic
1165118773 19:33545761-33545783 CCCTCCCAAAGGCACATGGCTGG + Intergenic
1165304261 19:34994090-34994112 TATTCCCCAAGGCTGAGGTCTGG - Intergenic
1168010065 19:53522789-53522811 TCCTCCCCAAGGGATGTGACAGG + Intronic
925410019 2:3634673-3634695 TCTTCCCGATGGCAGATGCCAGG - Intronic
926675913 2:15619405-15619427 GCATCCCCAAGGCAGCTGACTGG - Intronic
926965804 2:18409377-18409399 TCCTGCCAAAGGCAGATCTGAGG + Intergenic
927141619 2:20134983-20135005 TCCTCCCCACAGCAAATATCTGG - Intergenic
929904740 2:46036085-46036107 TCCTCCCCCAGGCATATGAGTGG - Intronic
930052305 2:47225890-47225912 TCCTTCCCAAGGCCAATGTGTGG + Intergenic
931516650 2:63054136-63054158 TCCTCCCGCATGAAGATGTCAGG - Exonic
932535268 2:72586172-72586194 TATTTCCCAAGGCTGATGTCTGG - Intronic
932610046 2:73192040-73192062 GCCTCCCCAAGGCAGCTCTGGGG + Intergenic
936233454 2:110724429-110724451 TCCTTCCCCAGGCACATGTCTGG + Intergenic
937267896 2:120628628-120628650 ACGTCCCCAAGGCAGCAGTCAGG - Intergenic
941202069 2:162524438-162524460 TCAGCCCTAAGGAAGATGTCTGG + Intronic
941391718 2:164923148-164923170 TCCTCGCCAAGGCCAATGTCGGG - Intronic
941493293 2:166169253-166169275 TCTTCACCAAGGCTGATGTCAGG - Intergenic
946885603 2:224219533-224219555 TCCTCCCCATTGCAAATGGCGGG - Intergenic
947072728 2:226309152-226309174 TGCTCCCCATGACACATGTCTGG - Intergenic
948055132 2:235005307-235005329 TCCACCGCAAGCCAGAAGTCAGG - Intronic
948230957 2:236349042-236349064 TCCTACCCAAGCCAGAGGCCTGG + Intronic
1168928072 20:1599080-1599102 TCCAACCCAAGGCAGAAGCCAGG + Intronic
1168954535 20:1825883-1825905 TCCTTCCCAAGGCACAGGGCAGG + Intergenic
1169132194 20:3172121-3172143 CCCTCCCCCAGGCAGCTGCCAGG + Intronic
1169475919 20:5931038-5931060 ACCTCAACAAGGCAGATGCCAGG - Intergenic
1169759291 20:9074000-9074022 TCCTCCCAGAGGCAGCTGGCTGG + Intronic
1171134454 20:22684304-22684326 TCCTCCTTAAGGCCGACGTCTGG - Intergenic
1171257527 20:23701433-23701455 TCCATGCCAAGGCAGATATCTGG + Intergenic
1171448970 20:25223044-25223066 TGCTCCCCGAGGCAGAGGGCTGG + Intronic
1173452654 20:43178850-43178872 ACTTCCCCAAGGCAGATGAAGGG + Intronic
1173809989 20:45949728-45949750 TCCTCCCCAAGGTAGGTCTTTGG + Intronic
1175659908 20:60803679-60803701 TGCTCCCCAAGGCAGGGGTCAGG - Intergenic
1175974955 20:62706147-62706169 TTCTACACAAGGCAGATGGCAGG - Intergenic
1176064609 20:63188098-63188120 ACCTCCCCAGGGCTGATGTCTGG - Intergenic
1177870600 21:26568536-26568558 TCCTTCCCAAGGCTGATGTCAGG - Intronic
1179544138 21:42103258-42103280 TCCTCCTCCAGGCAAATGTTGGG - Exonic
1179774448 21:43651898-43651920 TCCTCCCAAAGGGAGATGCTGGG + Intronic
1180200336 21:46220276-46220298 GCGTCCCCAAGGCTGCTGTCCGG - Intronic
1181807557 22:25384272-25384294 TCCTCACCAAGGCCGGTGTTTGG - Intronic
1181861246 22:25820314-25820336 CCCTACCCAAGGAAGAGGTCTGG - Intronic
1182435168 22:30325818-30325840 TCCTCCCAAGGGCAGATCTTGGG - Intronic
1183320846 22:37164252-37164274 TCCTCCCTAAGCCAGGCGTCAGG + Intronic
951405953 3:22297349-22297371 TCCTCCCAAAGGCAGAGGTCTGG - Intronic
951979203 3:28547077-28547099 ACTTCCCCAAAGAAGATGTCAGG - Intergenic
952176454 3:30868870-30868892 GCCTCCCCCAACCAGATGTCTGG - Intronic
954070935 3:48142452-48142474 TCCTGACCCAGCCAGATGTCTGG + Intergenic
954438664 3:50509616-50509638 TACTCCCCTGGGCAGATGTTTGG - Intergenic
954826696 3:53379866-53379888 TCCCCCCCAAGGCAAGTGGCAGG + Intergenic
956739611 3:72265390-72265412 TCCTCCCCAGGGTAGATGTCAGG - Intergenic
959298718 3:104572622-104572644 TCTTTCCCAAGGCTGAGGTCAGG + Intergenic
959486832 3:106936419-106936441 TCCTCCCCACTGCAAACGTCAGG + Intergenic
959712916 3:109402588-109402610 TGGTCCCCAAGGCAAATGTCAGG + Intergenic
959948241 3:112149771-112149793 TCCCCACCCAGGCAGATCTCAGG - Intronic
963046217 3:141104501-141104523 TCCTCTGCATGGCAGATGGCTGG + Intronic
963472647 3:145762001-145762023 TCCTCATCAAGGCAGTTGCCTGG + Intergenic
964760227 3:160128509-160128531 TCCTCCTTAAGGCAGATGTGGGG + Intergenic
965340695 3:167487453-167487475 TCTTTGCCAAGGCTGATGTCAGG - Intronic
967960109 3:194913624-194913646 TCCTCCCCAAGTCACATGAAAGG + Intergenic
972258138 4:37381140-37381162 TCCTCCACAGGGCACATTTCAGG - Intronic
972726119 4:41747389-41747411 TCCTCCCGAGTGTAGATGTCGGG + Exonic
977045865 4:92068838-92068860 TCCACCCCTAGTCAGATGTATGG - Intergenic
977133169 4:93267929-93267951 TACTCCCCAAGTCAGATCTGGGG + Intronic
977358884 4:95980231-95980253 TCCACCCCAATGAGGATGTCGGG + Intergenic
978785363 4:112603143-112603165 TGCTACCAAAGGCAGATTTCTGG - Intronic
980339854 4:131531400-131531422 TCCTCCCCACTGCAAATGACAGG + Intergenic
985031488 4:185794872-185794894 TTCTCCCCAGGCCAGAGGTCTGG - Intronic
985375414 4:189332404-189332426 TCGTTCCCAAGGCTGATGTCAGG - Intergenic
985529372 5:424850-424872 TCCTCCCCATCGGACATGTCAGG + Intronic
986012862 5:3732494-3732516 TTCTCCACAAGGCAGATCTGCGG + Intergenic
986216610 5:5725434-5725456 TGCTCCCCAAGGCAGGGGTTTGG - Intergenic
986486322 5:8242055-8242077 TCCTCTACAAGGCAGAGGTGAGG + Intergenic
990534852 5:56711008-56711030 TCTTTCCCAAGACTGATGTCCGG - Intergenic
992173662 5:74128263-74128285 TGCTTCCCGAGGCAGATGGCAGG + Intergenic
992387939 5:76303779-76303801 TCCTCCATGAAGCAGATGTCAGG + Intronic
993386407 5:87267962-87267984 TCCTCCACCAGGCAGATGAGAGG - Exonic
995470917 5:112501212-112501234 TCCTCCCCATTGCAAATGGCAGG - Intergenic
996612335 5:125397261-125397283 TGCTCCCCTAGGGAGATGTATGG + Intergenic
997284312 5:132667552-132667574 TCCTCCCCAAGCCAGAGACCTGG + Intergenic
999743578 5:154575003-154575025 CCCTCCCCAAGGCAGCAGTGGGG - Intergenic
1002857227 6:1048676-1048698 TCCTACCCGAGGTAGATGACTGG + Intergenic
1003224666 6:4192559-4192581 TCCTCCCCAAAGCAGAGTTCAGG - Intergenic
1003909522 6:10730510-10730532 TCCTCCCCCACGCAGTTGTGAGG + Intronic
1004824628 6:19405724-19405746 GCCTCCCCGAGGCAGTTGCCAGG - Intergenic
1004893517 6:20124506-20124528 TCATCCACAAGGCAGGTGACAGG + Exonic
1006297943 6:33178341-33178363 TCCTCCTCCAGGGAGATGACGGG - Exonic
1009390431 6:63137553-63137575 GCCTCCCCAAGAGAGTTGTCAGG - Intergenic
1011559449 6:88599876-88599898 TCCTCACGAAGGCAGATGCTAGG + Intergenic
1014285693 6:119494769-119494791 TCCTCTCCATGGCAGAAGTATGG - Intergenic
1016894108 6:149035947-149035969 CCATCCCCAAAGCAGATGTTTGG - Intronic
1018239622 6:161760485-161760507 TCCTCCCCACTGCAGAGGGCAGG - Intronic
1019525005 7:1476906-1476928 CCCTCCCCAGGGCAAAGGTCAGG - Exonic
1024592946 7:50905429-50905451 TCCTTGCCAAGGCCAATGTCCGG - Intergenic
1025248526 7:57336127-57336149 ACCTCCCCAAGGTGGATGCCAGG + Intergenic
1029976288 7:104837371-104837393 TCCTCCTCATTGCAGATGGCTGG - Intronic
1032304885 7:130723202-130723224 TCATCCCCAATGCAGACTTCTGG - Intergenic
1035234140 7:157485355-157485377 TCCTGCCCCCGGCAGAGGTCTGG + Intergenic
1036665811 8:10737170-10737192 CCCACCCCAAGGCCAATGTCAGG + Intronic
1037917681 8:22782428-22782450 TGCCCCCAAAGGCAGAGGTCTGG - Intronic
1042941719 8:74114898-74114920 TCCTCCCCCAGGCAGAACTTTGG - Intergenic
1044396672 8:91721001-91721023 TCCTACCCAAGGGAGATGACTGG - Intergenic
1045431901 8:102122905-102122927 ACCTACCCAAGCCAGATCTCTGG - Intronic
1048086106 8:131181680-131181702 TCTTTCCCAAGGCCTATGTCTGG + Intergenic
1050270699 9:3941479-3941501 TCTGCCACCAGGCAGATGTCTGG + Intronic
1050617892 9:7421587-7421609 TCTTTCCCAAGGCTGAGGTCGGG + Intergenic
1051703002 9:19844584-19844606 TCTTTCCCAAGGCCAATGTCTGG + Intergenic
1052059441 9:23942459-23942481 ACCTCCCCAAGACAGATTTTTGG - Intergenic
1057996050 9:99822336-99822358 TCCCCCCCAGTGCAGATTTCGGG + Exonic
1060217183 9:121745504-121745526 TCCTCCCAAAGCCTGAGGTCTGG - Intronic
1061498675 9:130990142-130990164 TCCTCCCACAGGCTGGTGTCCGG - Intergenic
1061499320 9:130993174-130993196 TCCTCCCCTGGGCAGGTGGCAGG - Intergenic
1186345207 X:8684877-8684899 GCGTCCCCAAGGAAGATCTCGGG + Intronic
1191630422 X:63315710-63315732 GCCTCCCTAAGGCAGTTGCCAGG - Intergenic
1192221106 X:69197872-69197894 TCCACCCCACTGCAGATGCCTGG + Intergenic
1192781108 X:74294297-74294319 TCCTCTCCAAAGCAGCTCTCAGG + Intergenic
1195378348 X:104249284-104249306 TCCTCCACAAAGCAGAGGGCAGG + Intergenic