ID: 1137983200

View in Genome Browser
Species Human (GRCh38)
Location 16:53086985-53087007
Sequence TCCTATCCCCACCATGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 208}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137983194_1137983200 3 Left 1137983194 16:53086959-53086981 CCTTTTCCCTTCCAGGGGGCCAC 0: 1
1: 0
2: 1
3: 25
4: 263
Right 1137983200 16:53086985-53087007 TCCTATCCCCACCATGCACCTGG 0: 1
1: 0
2: 1
3: 27
4: 208
1137983195_1137983200 -3 Left 1137983195 16:53086965-53086987 CCCTTCCAGGGGGCCACACCTCC 0: 1
1: 0
2: 0
3: 25
4: 251
Right 1137983200 16:53086985-53087007 TCCTATCCCCACCATGCACCTGG 0: 1
1: 0
2: 1
3: 27
4: 208
1137983196_1137983200 -4 Left 1137983196 16:53086966-53086988 CCTTCCAGGGGGCCACACCTCCT 0: 1
1: 0
2: 1
3: 36
4: 336
Right 1137983200 16:53086985-53087007 TCCTATCCCCACCATGCACCTGG 0: 1
1: 0
2: 1
3: 27
4: 208
1137983192_1137983200 5 Left 1137983192 16:53086957-53086979 CCCCTTTTCCCTTCCAGGGGGCC 0: 1
1: 0
2: 1
3: 33
4: 326
Right 1137983200 16:53086985-53087007 TCCTATCCCCACCATGCACCTGG 0: 1
1: 0
2: 1
3: 27
4: 208
1137983187_1137983200 15 Left 1137983187 16:53086947-53086969 CCTTTCTGCACCCCTTTTCCCTT 0: 1
1: 0
2: 2
3: 75
4: 700
Right 1137983200 16:53086985-53087007 TCCTATCCCCACCATGCACCTGG 0: 1
1: 0
2: 1
3: 27
4: 208
1137983197_1137983200 -8 Left 1137983197 16:53086970-53086992 CCAGGGGGCCACACCTCCTATCC 0: 1
1: 0
2: 1
3: 13
4: 171
Right 1137983200 16:53086985-53087007 TCCTATCCCCACCATGCACCTGG 0: 1
1: 0
2: 1
3: 27
4: 208
1137983186_1137983200 16 Left 1137983186 16:53086946-53086968 CCCTTTCTGCACCCCTTTTCCCT 0: 1
1: 0
2: 4
3: 71
4: 696
Right 1137983200 16:53086985-53087007 TCCTATCCCCACCATGCACCTGG 0: 1
1: 0
2: 1
3: 27
4: 208
1137983193_1137983200 4 Left 1137983193 16:53086958-53086980 CCCTTTTCCCTTCCAGGGGGCCA 0: 1
1: 0
2: 1
3: 27
4: 287
Right 1137983200 16:53086985-53087007 TCCTATCCCCACCATGCACCTGG 0: 1
1: 0
2: 1
3: 27
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137983200 Original CRISPR TCCTATCCCCACCATGCACC TGG Intronic