ID: 1137983200

View in Genome Browser
Species Human (GRCh38)
Location 16:53086985-53087007
Sequence TCCTATCCCCACCATGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 208}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137983187_1137983200 15 Left 1137983187 16:53086947-53086969 CCTTTCTGCACCCCTTTTCCCTT 0: 1
1: 0
2: 2
3: 75
4: 700
Right 1137983200 16:53086985-53087007 TCCTATCCCCACCATGCACCTGG 0: 1
1: 0
2: 1
3: 27
4: 208
1137983196_1137983200 -4 Left 1137983196 16:53086966-53086988 CCTTCCAGGGGGCCACACCTCCT 0: 1
1: 0
2: 1
3: 36
4: 336
Right 1137983200 16:53086985-53087007 TCCTATCCCCACCATGCACCTGG 0: 1
1: 0
2: 1
3: 27
4: 208
1137983186_1137983200 16 Left 1137983186 16:53086946-53086968 CCCTTTCTGCACCCCTTTTCCCT 0: 1
1: 0
2: 4
3: 71
4: 696
Right 1137983200 16:53086985-53087007 TCCTATCCCCACCATGCACCTGG 0: 1
1: 0
2: 1
3: 27
4: 208
1137983193_1137983200 4 Left 1137983193 16:53086958-53086980 CCCTTTTCCCTTCCAGGGGGCCA 0: 1
1: 0
2: 1
3: 27
4: 287
Right 1137983200 16:53086985-53087007 TCCTATCCCCACCATGCACCTGG 0: 1
1: 0
2: 1
3: 27
4: 208
1137983194_1137983200 3 Left 1137983194 16:53086959-53086981 CCTTTTCCCTTCCAGGGGGCCAC 0: 1
1: 0
2: 1
3: 25
4: 263
Right 1137983200 16:53086985-53087007 TCCTATCCCCACCATGCACCTGG 0: 1
1: 0
2: 1
3: 27
4: 208
1137983195_1137983200 -3 Left 1137983195 16:53086965-53086987 CCCTTCCAGGGGGCCACACCTCC 0: 1
1: 0
2: 0
3: 25
4: 251
Right 1137983200 16:53086985-53087007 TCCTATCCCCACCATGCACCTGG 0: 1
1: 0
2: 1
3: 27
4: 208
1137983197_1137983200 -8 Left 1137983197 16:53086970-53086992 CCAGGGGGCCACACCTCCTATCC 0: 1
1: 0
2: 1
3: 13
4: 171
Right 1137983200 16:53086985-53087007 TCCTATCCCCACCATGCACCTGG 0: 1
1: 0
2: 1
3: 27
4: 208
1137983192_1137983200 5 Left 1137983192 16:53086957-53086979 CCCCTTTTCCCTTCCAGGGGGCC 0: 1
1: 0
2: 1
3: 33
4: 326
Right 1137983200 16:53086985-53087007 TCCTATCCCCACCATGCACCTGG 0: 1
1: 0
2: 1
3: 27
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137983200 Original CRISPR TCCTATCCCCACCATGCACC TGG Intronic
900119410 1:1042131-1042153 TGCCATCCCCAGCAAGCACCAGG + Exonic
900230638 1:1555284-1555306 TCTCATCCCCGCCATGCACCAGG - Intronic
900322749 1:2093228-2093250 ACCTGACCACACCATGCACCTGG - Intronic
900414247 1:2527846-2527868 TCCTCTGCCCACCATACCCCGGG + Intergenic
900569454 1:3351207-3351229 TCTCATCCCCACCAGGCACTTGG + Intronic
902847908 1:19126714-19126736 TCCCATCCCCAACACCCACCTGG - Intronic
903191957 1:21661908-21661930 TTCTCTGCCCACCATGCACATGG - Intronic
904846808 1:33425864-33425886 TTCTATGCCCAACATGGACCAGG - Intronic
905030572 1:34880923-34880945 TCCTATCCCCAAAAGGCATCAGG + Intronic
906642976 1:47452565-47452587 CCCTATCCCCAACAAGCACTTGG - Intergenic
907490020 1:54803092-54803114 TTCTCTCCCCACCCAGCACCTGG + Intergenic
907941818 1:59095609-59095631 TCCTAACCCCATCATGTTCCTGG + Intergenic
908392590 1:63697089-63697111 CTCCATCCCCACCATCCACCAGG - Intergenic
909896620 1:81078813-81078835 TCATATCCCCACCATGCTGGTGG + Intergenic
912454616 1:109789197-109789219 CCCGGCCCCCACCATGCACCTGG + Intergenic
914199805 1:145474936-145474958 TCCTATCCCCAGGATGGGCCTGG - Intergenic
914201116 1:145486644-145486666 TCCTATCCCCAGGATGTGCCTGG - Intergenic
914313234 1:146486176-146486198 TCCTATCCCCAGGATGGGCCTGG - Intergenic
914478924 1:148048071-148048093 TCCTATCCCCAGGATGGGCCTGG - Intergenic
914480229 1:148059776-148059798 TCCTATCCCCAGGATGTGCCTGG - Intergenic
914501113 1:148247205-148247227 TCCTATCCCCAGGATGGGCCTGG + Intergenic
915095896 1:153461651-153461673 CCCTTTCCTCACCATGCCCCAGG - Intergenic
915218222 1:154353881-154353903 TCTTCTTCCCACCATGCCCCAGG + Intergenic
915263263 1:154694731-154694753 TCCCATCCCAACTATGCACTTGG - Intergenic
915915568 1:159938416-159938438 CCCTATCCTCTCCATGCCCCGGG + Intronic
915924232 1:160004025-160004047 CCCACTCACCACCATGCACCTGG + Intergenic
916046019 1:161000448-161000470 TCCTACTCTCACCATGCCCCTGG + Intronic
916434872 1:164768709-164768731 TCATCTCCCCACCATGGACCTGG + Intronic
916452780 1:164937134-164937156 TCATATTCCCACTATGAACCAGG + Intergenic
920174634 1:204092793-204092815 GCCTGTCCCCACCACACACCGGG - Intronic
922344192 1:224682592-224682614 TACCAGCCTCACCATGCACCTGG + Intronic
923503587 1:234586482-234586504 TCCTATCCCCGCCTTGTTCCAGG + Intergenic
1064152303 10:12875057-12875079 CCCTGTGCCCACCTTGCACCTGG - Intergenic
1067159152 10:43808061-43808083 TTCTATCCCCACATTGCACCTGG + Intergenic
1067321366 10:45224212-45224234 CCCCATCCCCTCCCTGCACCCGG - Intergenic
1072287080 10:93926544-93926566 TCCTGTCACAACCAGGCACCTGG + Intronic
1075023215 10:118966316-118966338 TCCTTTCTCCTCCAAGCACCAGG + Intergenic
1075656873 10:124167833-124167855 TCCTCTCCCCACCAAGGCCCAGG - Intergenic
1076431119 10:130403078-130403100 TCTTATCTCCACTATCCACCGGG - Intergenic
1076630322 10:131848452-131848474 TCCTGTCCCCGCCAGGCCCCAGG - Intergenic
1076840736 10:133043961-133043983 TCCTAACACCACCCTGCCCCAGG + Intergenic
1078667613 11:13339609-13339631 TCCTCTCCCTAGCATGCCCCAGG + Intronic
1081153771 11:39664187-39664209 TCCTATGCCCAGCCTGCAGCGGG - Intergenic
1083816839 11:65137599-65137621 TACCATCCCTACCATGCCCCAGG + Intergenic
1084573825 11:69976015-69976037 GCCTGTCCCCACCATGCTCTGGG + Intergenic
1086027960 11:82317902-82317924 TCCTATCCCCAAAAATCACCAGG + Intergenic
1086445727 11:86868498-86868520 TCCTAGCCCCACAAGGCACTGGG + Intronic
1087203123 11:95365933-95365955 TCTTATGTCCTCCATGCACCTGG + Intergenic
1089155690 11:116400562-116400584 TCCTCTCCCCACCATCCACACGG + Intergenic
1089288020 11:117420082-117420104 TCCCATCCCCACCCTCCCCCAGG - Intergenic
1091333735 11:134751385-134751407 TTCTATCCTCACCAGGCACCAGG - Intergenic
1091455933 12:607836-607858 TCCTATCTCCACCCCGCAGCAGG - Intronic
1092395660 12:8123298-8123320 TGCCATCCCCACCATGCTACAGG + Intergenic
1092887798 12:12940631-12940653 TCCTAACCCCTCCATCCACCAGG - Intergenic
1095948622 12:47768303-47768325 TCCTCTCTCCACCAAGCAGCTGG - Intronic
1096198326 12:49663445-49663467 TCCTCTCCCCACCTTGCCCTGGG + Intronic
1098162540 12:67659106-67659128 TCCTTTTCCCTCCATGCTCCAGG + Exonic
1099977807 12:89564616-89564638 TCCTTTCCTCAACATGCACATGG + Intergenic
1100927000 12:99559518-99559540 TCTTTTCCCCACCATGCAACTGG - Intronic
1101363490 12:104049894-104049916 CCCTACCCTCACCATTCACCAGG - Exonic
1104310323 12:127648997-127649019 CCCTCTCCCCTCCAGGCACCAGG + Intergenic
1105721316 13:23117644-23117666 TCAAATGCCTACCATGCACCAGG + Intergenic
1105883939 13:24626644-24626666 TCCTGTCCCCACCCCGCACTGGG - Intergenic
1107437668 13:40394587-40394609 TTCTTTCCCCAACATGAACCTGG + Intergenic
1108365165 13:49703655-49703677 TCCTATAGCCACAATGAACCTGG + Intronic
1113577510 13:111404646-111404668 TCCTCTCCCCACCAGCCACAGGG + Intergenic
1116693735 14:48145757-48145779 TCCTATCCCCACCTAAGACCTGG + Intergenic
1117285428 14:54282217-54282239 TTTTATCCCCACCATTCAGCAGG + Intergenic
1119420621 14:74505884-74505906 TCCTCACCCCTCCATGCACCAGG + Intronic
1119658612 14:76435026-76435048 TCCTATCCCCACCTTACAGAAGG - Intronic
1121434667 14:93911170-93911192 TCCCTTCCCCACCATCCAGCAGG + Intergenic
1122783934 14:104155372-104155394 TCCTAACCACAGCAGGCACCAGG - Intronic
1127995153 15:64149646-64149668 TCCTCTCCCCATCATGCACTAGG - Intergenic
1128388545 15:67167273-67167295 TACTGTCCCCAGAATGCACCAGG - Intronic
1130144757 15:81265509-81265531 ACCTCTCCCCACCACGCACCTGG + Intronic
1134279076 16:12802141-12802163 TCCCTTCCCCACCATGCCCCAGG - Intronic
1136282919 16:29224468-29224490 GCACAGCCCCACCATGCACCCGG + Intergenic
1137820027 16:51435340-51435362 TCCTATCCACACCATGGAGGTGG + Intergenic
1137983200 16:53086985-53087007 TCCTATCCCCACCATGCACCTGG + Intronic
1138068810 16:53970089-53970111 TACTCTCCTCACCATGCAACAGG - Intronic
1142087295 16:88190364-88190386 GCACAGCCCCACCATGCACCCGG + Intergenic
1142154634 16:88527486-88527508 GCCTGTCCCCACCCTGCACTGGG - Intronic
1143189790 17:5033088-5033110 GCCGACCCCCACCATGCAGCAGG + Exonic
1144163018 17:12580324-12580346 TCCCCTCCCCACCATGGCCCGGG - Intergenic
1146187103 17:30731405-30731427 TTCTCTCCCCACAATGCACCGGG + Intergenic
1146332138 17:31936765-31936787 TTCTCTCCCCACAATGCACCGGG + Intergenic
1146923779 17:36730495-36730517 TCCATTCCCCACCCTGGACCAGG - Intergenic
1147155343 17:38541990-38542012 TCCTCTCCCCAGCCTCCACCTGG - Intronic
1147555362 17:41475659-41475681 TCCCAGCCCCACCTTGCTCCTGG - Intergenic
1149666197 17:58366344-58366366 GCCTCTCCCCTCCACGCACCAGG + Intronic
1150613705 17:66753172-66753194 TCCTCTCCCCACCAGTCCCCAGG + Intronic
1151050190 17:70969536-70969558 TCCTATTCCCACCAAGAAGCTGG - Intergenic
1151387533 17:73764338-73764360 TTCTATCCCCTCCCTGCCCCCGG + Intergenic
1152624560 17:81382294-81382316 TCCTGTCCCCATCACACACCAGG + Intergenic
1153726491 18:7961693-7961715 TCCTATTCCCAGCAAGCAGCAGG - Intronic
1153774284 18:8439161-8439183 TGCTCTCCCCAGCATGCCCCAGG + Intergenic
1155177075 18:23310261-23310283 TCCTTTCCCCAGGATGCACCTGG - Intronic
1158095255 18:53763168-53763190 TCCAATTCCCACCATACACCAGG + Intergenic
1158550335 18:58430595-58430617 CCCTATTCCCACCAGGCTCCTGG - Intergenic
1159166582 18:64710087-64710109 CCCCATCCCCACCATCCTCCAGG - Intergenic
1159585122 18:70276850-70276872 CCTTATCCCCACCATCCCCCAGG + Intergenic
1163555967 19:17993075-17993097 TCCCAGCCCCACCAAGCCCCTGG - Intronic
1166102762 19:40580827-40580849 CCAAAGCCCCACCATGCACCCGG - Exonic
1166129559 19:40737814-40737836 TGGTTTCCCCTCCATGCACCTGG - Intronic
925307417 2:2859077-2859099 TCCTATCCCCATCATTACCCAGG + Intergenic
925682529 2:6437934-6437956 TCCTATACTCACCATGCCCTTGG + Intergenic
929573515 2:43038488-43038510 TCCTCTCCCCACTCTGCCCCAGG + Intergenic
931839359 2:66132178-66132200 ACCCCTCCCCACCATGCTCCAGG - Intergenic
933710848 2:85324877-85324899 TCCTATCCCTCCCATGGACCTGG + Intronic
934297834 2:91757037-91757059 TCCTGTCTCCACCATTCACTAGG - Intergenic
934657455 2:96123576-96123598 TCCCATTCCCAGCATCCACCAGG + Intergenic
935094794 2:99934185-99934207 TCCTACTCCCACCAGGCACATGG - Intronic
935981053 2:108628044-108628066 TCCTTTCCTCTCCAAGCACCAGG + Intronic
941866086 2:170336173-170336195 TCCTGTCCCCTCAATTCACCAGG - Intronic
942070465 2:172311490-172311512 TCCTGTCCACACGATGAACCTGG + Intergenic
944861814 2:203822349-203822371 TGCTGTCCCCAGCCTGCACCTGG - Intergenic
945032715 2:205680598-205680620 ACCTCTCCCCACCACTCACCAGG - Intergenic
946272463 2:218605710-218605732 TCCTATTTCCACCATGATCCTGG - Intergenic
946639951 2:221773457-221773479 TCCTTTCCAGAACATGCACCAGG + Intergenic
947103454 2:226645868-226645890 GGCTATCCCCACCCTACACCCGG + Intergenic
949047621 2:241879350-241879372 TCCTAACCCAACCCTGCAACAGG - Intergenic
1168853021 20:989563-989585 TGCCACCCCCACCATGCACTGGG - Intronic
1169068473 20:2707598-2707620 TCCTGTGCCCACCCAGCACCAGG - Intronic
1170441484 20:16384265-16384287 CCCTGTCCCCACCAGGCTCCCGG + Intronic
1172698046 20:36835716-36835738 TCCTCTCCCCACGCTGCAGCTGG - Intronic
1173911661 20:46675132-46675154 TCCTCTCCCCACTATTCCCCTGG - Intronic
1176061328 20:63174177-63174199 CCCTCTCCCCACCAGGCACGGGG + Intergenic
1176382327 21:6119608-6119630 CCCCATCCCCACCATCAACCTGG - Intronic
1178385030 21:32142120-32142142 TCTCAGCCCCACCATGCATCCGG + Intergenic
1179317199 21:40254371-40254393 TCCCATCACCACCTTCCACCGGG - Intronic
1179435258 21:41358339-41358361 TCCAAGCCCCACCAAGCTCCTGG + Intergenic
1179741145 21:43418631-43418653 CCCCATCCCCACCATCAACCTGG + Intronic
1181433120 22:22894860-22894882 TCCTATCCCTCACAGGCACCGGG - Intronic
1181985881 22:26799532-26799554 TGGTGGCCCCACCATGCACCAGG - Intergenic
1182738804 22:32551328-32551350 CCCTACCCCCACCCTGCACCAGG + Intronic
1183086193 22:35488735-35488757 GCCTTTCCCCACTCTGCACCTGG - Intergenic
1183386442 22:37518172-37518194 TTCTGCCCCCACCATGCTCCAGG + Intronic
1184355106 22:43974551-43974573 TCCTATCTCCATCTTGAACCTGG - Intronic
1184880378 22:47300695-47300717 TCCTCACCCCCACATGCACCTGG - Intergenic
1185033583 22:48458992-48459014 GTCTATCCCAACCATGCACTTGG - Intergenic
1185242151 22:49752332-49752354 TCTTATCCCCAGCATGCACTTGG + Intergenic
951106787 3:18753478-18753500 GCCTATACCCACAATGCAGCTGG + Intergenic
951315573 3:21185907-21185929 TGATCTCCCCACCATGCACCTGG - Intergenic
952870074 3:37891090-37891112 TCCTAACCCCAGCATGGAACAGG - Intronic
952933354 3:38376480-38376502 TTCTGTCCCCACCAAGCCCCTGG + Intronic
953191346 3:40690870-40690892 TCCCTTCCTCACCAAGCACCAGG - Intergenic
953493188 3:43366534-43366556 TCCCAACCCCACCATGGCCCAGG - Exonic
953709823 3:45260563-45260585 TGCTATCCCCACCTGGCACAGGG + Intergenic
954130771 3:48559710-48559732 GCCTCTGCCCACCATGAACCTGG + Intronic
954384887 3:50238764-50238786 TCCCATCACCACCTTGCACCTGG - Intronic
957040113 3:75329836-75329858 TCCCATCCCCACCTTCCTCCTGG - Intergenic
960213936 3:115006674-115006696 ACCTACCCCTATCATGCACCTGG + Intronic
965084195 3:164073277-164073299 TCCTATTCCCATCATACACCTGG + Intergenic
965296822 3:166957357-166957379 TGCTCTGCCCAGCATGCACCTGG + Intergenic
965345010 3:167537679-167537701 TCCCTTCCCCACCAGGCACAAGG - Intronic
966879017 3:184339154-184339176 TCCTAACTCCACCCTGTACCTGG - Intronic
967867207 3:194200011-194200033 ACCTCTCCTCACCATGCACAGGG - Intergenic
968150850 3:196335590-196335612 TCCTGACCCCACCCTGCCCCAGG - Intronic
968754449 4:2408212-2408234 CCCTAACCCCACCATGCCCTGGG + Intronic
969398402 4:6938036-6938058 CCCTCTCCCCACCCAGCACCCGG - Intronic
969959603 4:10930473-10930495 TACTTTCCCCACAATGCAGCAGG + Intergenic
973695596 4:53487515-53487537 CCCTCTCCCCACAATGCCCCAGG + Intronic
977302766 4:95286776-95286798 TCCTATTGGCACCATGCAGCCGG - Intronic
977818353 4:101442522-101442544 TCTTATACCCAAAATGCACCTGG - Intronic
977861828 4:101970488-101970510 TCCTATCACCACCACTCTCCTGG + Intronic
979746677 4:124223201-124223223 TCTTATCCCTATCATTCACCTGG - Intergenic
981568108 4:146122396-146122418 TCATATTCCCACCATAAACCAGG - Intergenic
985859484 5:2459358-2459380 TCTTATCCCCGAGATGCACCTGG + Intergenic
990750046 5:59004814-59004836 GCCTCTGCCCACCAAGCACCAGG + Intronic
991239839 5:64445126-64445148 ACCTACCCCCACTATGCCCCTGG + Intergenic
999175485 5:149628945-149628967 CTCTATTCCCACCATGAACCAGG + Exonic
1000058681 5:157633130-157633152 ACCTATCCCCACCTTGAACAGGG + Intronic
1001871439 5:175159610-175159632 TCCACTCCCCATCATGCATCTGG - Intergenic
1002021138 5:176365321-176365343 TCCTTCCTCCACCCTGCACCTGG + Intergenic
1010588487 6:77684473-77684495 ACCTATCCCCACCTTTCCCCAGG + Intergenic
1014158568 6:118139668-118139690 TGCTATCCCCACCATGTTTCTGG - Intronic
1016764648 6:147778456-147778478 TCCCTTGCCCACCATGAACCTGG + Intergenic
1016817178 6:148313736-148313758 TCCATTCCCCACCCTACACCCGG - Intronic
1019322314 7:421325-421347 TACGCTCCCCACCGTGCACCCGG + Intergenic
1019322338 7:421433-421455 TACGCTCCCCACCGTGCACCCGG + Intergenic
1019322358 7:421530-421552 CCCCCTCCCCACCGTGCACCTGG + Intergenic
1019456526 7:1130547-1130569 TCCTATCCCCACCCTCCCCAGGG + Intronic
1019564402 7:1672257-1672279 TCCCTTCCCCACCATGCCCCAGG + Intergenic
1019934707 7:4246714-4246736 TCCTCTCCTCACCAAGCAGCTGG + Intronic
1020078718 7:5275199-5275221 TCCAAACCCCTCCATGCAGCTGG - Intronic
1022983900 7:35630332-35630354 TCCTCTCCCCACCCTGTACCTGG + Intergenic
1024010214 7:45260434-45260456 TCCTGTCTCTACAATGCACCAGG - Intergenic
1024837687 7:53542722-53542744 TCCTCTCCCCTCCTTGCTCCTGG - Intergenic
1025200177 7:56956986-56957008 TCCAAACCCCTCCATGCAGCTGG + Intergenic
1025671768 7:63619946-63619968 TCCAAACCCCTCCATGCAGCTGG - Intergenic
1026737813 7:72960153-72960175 CCCTATCCCCTCCAGGCAGCGGG + Exonic
1026788848 7:73318954-73318976 CCCTATCCCCTCCAGGCAGCGGG + Exonic
1026869200 7:73840507-73840529 TCCCATCCACCCCATGCAGCTGG + Exonic
1026950355 7:74342584-74342606 TCCCATCCCCACCAAGCAGCAGG - Intronic
1027052491 7:75028915-75028937 TCCTCTCACCTCCAGGCACCAGG + Intronic
1027105921 7:75404915-75404937 CCCTATCCCCTCCAGGCAGCGGG - Exonic
1029197615 7:98816828-98816850 TTCTGTTCCCACCATGTACCAGG - Intergenic
1029269091 7:99365776-99365798 GCCTGTCCCCACCCTGAACCTGG - Intronic
1029610678 7:101625068-101625090 TCCTATCCCCACCCTGAACCTGG + Intronic
1030155636 7:106451543-106451565 ACCTACCCCCACTATGCTCCTGG - Intergenic
1031137684 7:117902788-117902810 CCCTATCCCCATCCTGCCCCAGG + Intergenic
1032932518 7:136689960-136689982 TACTAGCCCCACAATGCTCCTGG - Intergenic
1035554435 8:555626-555648 CCTTATCCCCACCATCCCCCAGG - Intergenic
1035807643 8:2467515-2467537 TCCTAACCCCATCCTGGACCTGG - Intergenic
1036636966 8:10557848-10557870 TCCTGTCCCCACCCTTGACCTGG + Intergenic
1036707135 8:11054588-11054610 CCCTATCCCAGCCATGCTCCGGG + Intronic
1037325740 8:17688275-17688297 TCCTGTCCCCGCAAAGCACCAGG - Intronic
1038593317 8:28861265-28861287 TCCTGTCCCCACCCTCCATCTGG + Intronic
1038625803 8:29192313-29192335 TCCAATCACCTCCAGGCACCTGG + Intronic
1039655266 8:39397807-39397829 TCCTATCACCATCAAGCAACTGG - Intergenic
1040575807 8:48650226-48650248 TGCTCTCCCCACCCTGCCCCTGG - Intergenic
1043544090 8:81295650-81295672 TCATATTCCCACACTGCACCAGG - Intergenic
1044666763 8:94640565-94640587 TCCTTTCGCCTCCCTGCACCTGG + Intergenic
1048426367 8:134327739-134327761 TTTTCTCCCCACCATGCCCCTGG + Intergenic
1048463150 8:134639444-134639466 TCCCCTGCCCACCATGCCCCAGG - Intronic
1048931612 8:139319800-139319822 TCCTAGCCACACCATGGTCCAGG - Intergenic
1052974896 9:34402948-34402970 TACTATCTCCACCAAGCAGCAGG - Intronic
1053397139 9:37785327-37785349 TCGTATCCCCACGATGCGACCGG - Intronic
1057227080 9:93298076-93298098 TCCCATCCCAGCCCTGCACCCGG - Intronic
1057860336 9:98635949-98635971 TGCATACCCCACCATGCACCCGG + Intronic
1059389361 9:113989092-113989114 TCCGGTCTCCAGCATGCACCAGG + Intronic
1060802134 9:126551480-126551502 GCCCAGCCCCACTATGCACCAGG + Intergenic
1060856238 9:126916059-126916081 TCCTATCCTCACCAGGCCCCTGG - Intronic
1060877146 9:127091626-127091648 TCTTTTCCCTACCCTGCACCTGG + Intronic
1061133034 9:128718809-128718831 TCGTAGCCCCAGCCTGCACCTGG + Intronic
1061401653 9:130371725-130371747 TCCTATCCACAGAATGCACCCGG - Intronic
1061944938 9:133903369-133903391 TCCCATGCCCACCCTGCACCGGG + Intronic
1062641165 9:137519371-137519393 CCCACTCCCCACCAGGCACCTGG + Intronic
1186439304 X:9571739-9571761 TTCTCTCCCCACCAACCACCTGG + Intronic
1189635164 X:42999956-42999978 TCCTCACCCCACCATGAGCCAGG - Intergenic
1190508637 X:51154685-51154707 CCTTATCCCCACCATACACACGG - Intergenic
1190942575 X:55056567-55056589 TCCAATCCCCAACCTCCACCAGG - Intergenic
1197710811 X:129665957-129665979 CCCTATCCTCAGCCTGCACCTGG - Intergenic
1198147752 X:133874629-133874651 TACTCTCCCCAGCATGCAGCAGG + Intronic
1198316513 X:135472392-135472414 TCCTATCTCCACCACTCACTCGG - Intergenic
1199846175 X:151694561-151694583 ACCTACCCCCACCCTGCCCCGGG - Intergenic
1199889568 X:152063068-152063090 TCCTCTCCCCACTCAGCACCTGG + Intergenic