ID: 1137985208

View in Genome Browser
Species Human (GRCh38)
Location 16:53101511-53101533
Sequence AAACTTATGAAGTTACTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137985204_1137985208 7 Left 1137985204 16:53101481-53101503 CCCAGGCCGACAATTTTTTAATC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1137985208 16:53101511-53101533 AAACTTATGAAGTTACTGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 132
1137985205_1137985208 6 Left 1137985205 16:53101482-53101504 CCAGGCCGACAATTTTTTAATCA 0: 1
1: 0
2: 5
3: 59
4: 511
Right 1137985208 16:53101511-53101533 AAACTTATGAAGTTACTGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 132
1137985207_1137985208 1 Left 1137985207 16:53101487-53101509 CCGACAATTTTTTAATCAGGATG 0: 1
1: 0
2: 2
3: 15
4: 207
Right 1137985208 16:53101511-53101533 AAACTTATGAAGTTACTGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137985208 Original CRISPR AAACTTATGAAGTTACTGCC TGG Intronic
900815864 1:4844992-4845014 AAAATTAAGAGGTTACTGACAGG - Intergenic
903985246 1:27222701-27222723 AAAGTTATAAAGTTAGTGTCTGG + Intergenic
908194638 1:61736942-61736964 AAAGTTATAAAGTTATGGCCAGG - Intergenic
911434388 1:97837616-97837638 AAACTTTTGAAATAACTGTCTGG - Intronic
912435908 1:109660929-109660951 ACACTTATGAAGATTCTACCCGG - Intronic
912658876 1:111511089-111511111 AAAGTACTGAAGTTACTGTCAGG + Intronic
918297145 1:183167757-183167779 ATATTTATGAAGTTACTGAATGG - Intergenic
918302434 1:183216424-183216446 AAACTTATCAAGGTCCTGCAAGG + Intronic
918645571 1:186900332-186900354 AAACATATTAAGATACTTCCTGG + Intronic
920091929 1:203460559-203460581 AAACTTATGAATTGTCGGCCGGG + Intergenic
921647704 1:217637365-217637387 TAAATTATTAAGTTTCTGCCGGG + Intronic
921649440 1:217659008-217659030 AACCTGATGATATTACTGCCTGG + Intronic
924625165 1:245691232-245691254 AAACGTGTGAAGTGACTGCTTGG + Intronic
924795276 1:247288298-247288320 AACCTTATGAAGCTTGTGCCAGG - Intergenic
1066132155 10:32404772-32404794 TAACTTATGTGGTTACTGCAAGG - Intergenic
1068289365 10:54982732-54982754 AAACTTATGCAGTTAATACTAGG - Intronic
1068343807 10:55744101-55744123 AAACTTATCAAGGTACAACCTGG + Intergenic
1073633981 10:105178335-105178357 AAACTCAAAAAGCTACTGCCAGG + Intronic
1074647189 10:115470988-115471010 AAACTTATGAACTTATTGAAAGG - Intronic
1079736962 11:24009409-24009431 AAACTGATGTAGTTTCTGTCTGG + Intergenic
1081099744 11:38986833-38986855 AAACTCATGCTGTTACTGCTGGG - Intergenic
1081150844 11:39629364-39629386 AAACTTATGAAATAACTCCTGGG + Intergenic
1082655303 11:55847932-55847954 TAACTTTTGTAGTTACTGCCAGG - Intergenic
1086954215 11:92919248-92919270 AAAGTGATGAAATTACTGCATGG + Intergenic
1089714375 11:120343438-120343460 AAGCCTATGAAGCTAGTGCCTGG + Intronic
1089898635 11:121958292-121958314 AAAGTTATGAAAAAACTGCCTGG + Intergenic
1091924099 12:4329899-4329921 AAACTTATGTTGGTAGTGCCAGG + Intronic
1091986651 12:4915097-4915119 CAACCTGTGAAGTGACTGCCAGG - Exonic
1098595246 12:72266655-72266677 TAAATTATGAAGTCAGTGCCAGG - Intronic
1106580476 13:31013858-31013880 TAACTTCTGAAATTACTTCCTGG + Intergenic
1106931647 13:34672388-34672410 AAAATTATGAAATTGCTTCCAGG + Intergenic
1108111613 13:47080127-47080149 AAACTTATAAAGTTTAGGCCGGG + Intergenic
1111274559 13:85931803-85931825 ACCCATATGAAGTTACAGCCAGG - Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1118240571 14:64053668-64053690 AAAATTATGCAGTTAGTGGCTGG + Intronic
1119437690 14:74608857-74608879 AGACTTATTAAGTTTGTGCCAGG - Intronic
1119510212 14:75205452-75205474 AAAATTATTAATTTTCTGCCGGG - Intergenic
1123961261 15:25403277-25403299 AAACTTAGGAAGCTACTGAGGGG - Intronic
1125417808 15:39471537-39471559 AAATTTACAAAGTTTCTGCCAGG + Intergenic
1126794155 15:52246146-52246168 AAACTTATTAAGTATCTGCTGGG - Intronic
1129179211 15:73861407-73861429 AAATTTATAAAAATACTGCCTGG + Intergenic
1129671913 15:77612295-77612317 AAACTTACAAGGTGACTGCCTGG + Intergenic
1131346800 15:91656939-91656961 AAAATAATGCAGTTATTGCCAGG + Intergenic
1131731023 15:95281444-95281466 AAACCTATGCAGTTCCTGCGTGG + Intergenic
1136139649 16:28280638-28280660 AAATAAATGAAGTTACTGTCAGG - Intergenic
1137985208 16:53101511-53101533 AAACTTATGAAGTTACTGCCTGG + Intronic
1140881645 16:79203792-79203814 AAACCTTTGAAATTATTGCCAGG - Intronic
1140956138 16:79867947-79867969 AAAGTTTTGAGGTTAATGCCTGG + Intergenic
1141343935 16:83228188-83228210 AAACATATGCAGACACTGCCAGG - Intronic
1144921195 17:18766020-18766042 AAAATGAAGAAGTTAATGCCGGG - Intronic
1154356953 18:13628659-13628681 ATCCTTATGCAGTTTCTGCCGGG - Intronic
1156645796 18:39161080-39161102 AAACTCATAAAGTTACTGGTAGG + Intergenic
1157591585 18:48839305-48839327 AAACCTTTGAAGCTACAGCCAGG - Intronic
1157711300 18:49851630-49851652 AAACTTTTCAAGTTGCTACCAGG + Intronic
1159936312 18:74370727-74370749 AAGCTTCTGAAGTTCCTGCGGGG - Intergenic
1165960175 19:39527549-39527571 TAACATATGAATATACTGCCGGG + Intergenic
928307279 2:30180529-30180551 AAAAGCATGAAGTTTCTGCCTGG - Intergenic
928626568 2:33146015-33146037 AAAATTTTCAAGTAACTGCCAGG - Intronic
931447716 2:62340843-62340865 AAAAATATGAAGTTGCGGCCAGG - Intergenic
932869592 2:75384816-75384838 AAACTGCTGAATTTACTCCCTGG + Intergenic
934842056 2:97631760-97631782 AGACTTATGAAATTACTACAAGG - Intergenic
937897162 2:126986522-126986544 AAACTGCTGAAGGTACTCCCTGG + Intergenic
939137898 2:138318648-138318670 TAACTCATGAAGTTGCTGCGAGG - Intergenic
939191554 2:138922112-138922134 AAATTTTTGAAATTATTGCCGGG - Intergenic
941869795 2:170372197-170372219 AAACTTATCCAGTTAGTGGCTGG - Intronic
941895127 2:170621268-170621290 AAACCTATGAAGTAACCTCCTGG - Intronic
944309326 2:198215849-198215871 AAGCCAATGAAGTTACTGACTGG + Intronic
1169299159 20:4427290-4427312 AAAATTATGAAGTTAGGGCCGGG + Intergenic
1170675203 20:18472478-18472500 AAATTTATAAAGTTAATGGCTGG - Intronic
1171950346 20:31415865-31415887 GAAATAATGAAGATACTGCCTGG + Intergenic
1173266870 20:41491778-41491800 AGACTTCTCAAGTTTCTGCCAGG + Exonic
1173623311 20:44452856-44452878 ATACTTGTGAAGTCAGTGCCTGG - Intronic
1175434962 20:58939051-58939073 AAACTTTTAAAGTAAGTGCCTGG + Intergenic
1178137257 21:29641577-29641599 AAACCCATGCAGTCACTGCCAGG + Intronic
1181690499 22:24556222-24556244 AAGCTAATGAACTTACTTCCAGG - Intronic
1182010196 22:26994482-26994504 AAAGTTATGAAGTTAATTTCCGG + Intergenic
952055821 3:29444353-29444375 AAACTTATTAATTTAAAGCCTGG - Intronic
952106811 3:30079638-30079660 AAATTTATGAAGTTACAACATGG + Intergenic
952263224 3:31761176-31761198 AAAGTTAAGAAGTTTCCGCCAGG + Intronic
956105278 3:65810900-65810922 AAGGTAATGAAGGTACTGCCTGG - Intronic
957533892 3:81476072-81476094 AAATTTAAGAAGTTCGTGCCAGG + Intergenic
957742972 3:84298460-84298482 AAATTTTTTAAGTTACTGCCTGG - Intergenic
958254891 3:91314218-91314240 ACTGTCATGAAGTTACTGCCTGG + Intergenic
966280313 3:178218915-178218937 AAACTTATGAAGAGACTGTTGGG + Intergenic
966691317 3:182744535-182744557 AAACATATGACCATACTGCCAGG + Intergenic
968259935 3:197312820-197312842 AAATATATGAAGTTATTTCCAGG + Intergenic
969895855 4:10303832-10303854 AAACTGATAAAGTTTCTTCCAGG - Intergenic
970021602 4:11575391-11575413 AATTTTCTGAAGTTAGTGCCAGG + Intergenic
974172038 4:58279286-58279308 AAACTTATGAAATCACCGCTTGG + Intergenic
975310000 4:72893194-72893216 AAAGTTATGAAGTTACTGGCAGG + Intergenic
978873800 4:113613114-113613136 AAACTTATGTTCTTACTGTCAGG + Intronic
980172801 4:129310195-129310217 AAACTTATGAAGTATCGGCCGGG - Intergenic
980322947 4:131302948-131302970 AAACATATCAAGTCACTACCAGG + Intergenic
980498322 4:133613504-133613526 TAACTTAGGAAGTTACTGAGTGG + Intergenic
982547158 4:156748405-156748427 AAAATCATGTAGTTACTGCCAGG + Intergenic
984420489 4:179514886-179514908 AAACTCATGAAGATTCTGCAGGG + Intergenic
987926639 5:24350633-24350655 AAACTTTTGAAGTTATGGTCAGG + Intergenic
988183274 5:27825828-27825850 AAACTTTTCAAGTTACTGTTAGG - Intergenic
990251484 5:53920159-53920181 AAAGTTATGAAGGTACTTACGGG - Intronic
991625767 5:68599499-68599521 AAGCTTCTGAAGTTTCTGGCAGG + Intergenic
995964330 5:117885688-117885710 AAACTTATCAAGCTGCCGCCGGG - Intergenic
998323227 5:141252790-141252812 AAACTTCTGCAGTGACTTCCAGG - Intergenic
999804720 5:155071026-155071048 GAACTTCTGAATTGACTGCCTGG + Intergenic
1001630227 5:173169427-173169449 AAAATTATGAAATTTCTGCCAGG - Intergenic
1003810505 6:9774185-9774207 AAACTTATGAAGTAATTGCTTGG - Intronic
1005045557 6:21638887-21638909 AAATTTATGGAGATATTGCCAGG - Intergenic
1006636594 6:35465712-35465734 GATCTGATGAAGTTACTCCCAGG - Intronic
1008083671 6:47221370-47221392 AAATTTATGAAGTTATGGGCTGG - Intergenic
1008761344 6:54855038-54855060 AAAATTCTGAAGTTAGTGACAGG - Intronic
1008904743 6:56663911-56663933 AAACCTATGAAAAGACTGCCAGG + Intronic
1009878466 6:69535606-69535628 AAAGTCATAAAGTTCCTGCCTGG - Intergenic
1014399371 6:120968075-120968097 ACACTTATGAAGTGACTGGAAGG + Intergenic
1014627734 6:123749967-123749989 AAACTCATAAAGTTGCTGTCAGG - Intergenic
1016467352 6:144338958-144338980 AAACATATGTATTTACTGCAGGG + Intronic
1016944912 6:149521863-149521885 AGAATTGTGAAGTTACTGACAGG - Intronic
1020656363 7:10932645-10932667 AAAATTATGAATATACTTCCTGG + Exonic
1022644607 7:32218631-32218653 AAACTTATGAAATTAGGTCCAGG - Intronic
1023422509 7:39997126-39997148 AAAATTATGAAGATACTACAGGG + Intronic
1025016613 7:55444123-55444145 AAAATAAAGAAGTTACGGCCGGG - Intronic
1027889635 7:83954682-83954704 AAACTGCTAAAGTTACTGCCTGG - Intergenic
1030742191 7:113122933-113122955 AGACTTATGAAATTTCTGTCTGG + Intergenic
1034702612 7:153109402-153109424 AACCTTTTGAAGTCACTGCCAGG - Intergenic
1035051624 7:156002107-156002129 AAACTTATGAAACCACTGCGAGG + Intergenic
1038273470 8:26097189-26097211 AGAGTTTTGAAGTCACTGCCTGG + Intergenic
1042471034 8:69188436-69188458 GAACTTATGCAGTTATTGCAAGG - Intergenic
1043661082 8:82742161-82742183 AAACTGATGAAGGTACTGTCTGG + Intergenic
1046300962 8:112288432-112288454 ATCCCTATGAAGTGACTGCCTGG - Intronic
1048652401 8:136493243-136493265 ATAATTTTGAAGTTGCTGCCAGG + Intergenic
1052615615 9:30836562-30836584 AAACTGATGAACTTAATACCTGG - Intergenic
1055702361 9:78959214-78959236 AACCTTAAGAAATTACTGCCAGG - Intergenic
1056500050 9:87199876-87199898 AAACTTATTAATTTAATCCCAGG + Intergenic
1056557777 9:87704110-87704132 AGGCTGATGAAATTACTGCCCGG - Intronic
1057610572 9:96539482-96539504 AAACTTCTGAATTTTCAGCCAGG - Intronic
1058275375 9:103035380-103035402 AAACTTTGGAAGCTATTGCCAGG - Intergenic
1061735835 9:132657833-132657855 AAACATGTTAAGTTAGTGCCTGG - Intronic
1186311170 X:8320592-8320614 AAACCTCAGAAGTCACTGCCTGG + Intergenic
1187654964 X:21461644-21461666 CAACCTATGAAACTACTGCCAGG - Intronic
1188982490 X:36739480-36739502 CAACCTATGAACTTTCTGCCAGG + Intergenic
1192348313 X:70331780-70331802 TAAATTATCAAGTTACTACCTGG - Intronic
1194079229 X:89437697-89437719 AAACTAATGTACTTACTGCTTGG + Intergenic
1194298450 X:92155921-92155943 AAGCTACTGAAGTAACTGCCGGG - Intronic
1198136616 X:133757828-133757850 ATATTTATGAAGTAACTGCAAGG + Intronic
1200168723 X:154056022-154056044 TAACTTAAGAAGTTAGGGCCAGG + Intronic
1200431848 Y:3093004-3093026 AAACTAATGTACTTACTGCTTGG + Intergenic
1200616056 Y:5380882-5380904 AAGCTACTGAAGTAACTGCCGGG - Intronic
1202194890 Y:22290093-22290115 GAACTCATGCAGTTGCTGCCTGG + Intergenic