ID: 1137986774

View in Genome Browser
Species Human (GRCh38)
Location 16:53115523-53115545
Sequence CAACCTAAAAATATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137986769_1137986774 11 Left 1137986769 16:53115489-53115511 CCAGTAATGGCCAAAATCGCAAT 0: 1
1: 0
2: 1
3: 23
4: 83
Right 1137986774 16:53115523-53115545 CAACCTAAAAATATGGAGCTGGG 0: 1
1: 0
2: 0
3: 26
4: 196
1137986770_1137986774 1 Left 1137986770 16:53115499-53115521 CCAAAATCGCAATTACTTTTGCA 0: 4
1: 46
2: 179
3: 173
4: 229
Right 1137986774 16:53115523-53115545 CAACCTAAAAATATGGAGCTGGG 0: 1
1: 0
2: 0
3: 26
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137986774 Original CRISPR CAACCTAAAAATATGGAGCT GGG Intronic
901396743 1:8987318-8987340 AAAACTAAAACTAAGGAGCTGGG + Intergenic
901729865 1:11271582-11271604 CAAACTAAAGAGGTGGAGCTGGG - Intergenic
901809375 1:11758508-11758530 AAACCTAAAATTATGGACATGGG + Intergenic
903831196 1:26176251-26176273 CAAAAAAAAAATTTGGAGCTGGG - Intergenic
908745240 1:67370293-67370315 CAACCTATAAATCAGGAGCCGGG - Intronic
908949550 1:69543502-69543524 CAACCAAAAAATATACAGCATGG + Intergenic
915893517 1:159792967-159792989 CAACCTGAAAATATATTGCTAGG + Intergenic
918064042 1:181087750-181087772 CAAGGTAAAAATATAGTGCTAGG - Intergenic
920245697 1:204585835-204585857 CCACCTAAAAATGTGGACCGTGG + Intergenic
924061436 1:240178988-240179010 TAACTTAAAAGCATGGAGCTTGG + Intronic
1063829756 10:9938919-9938941 GAACATAAAAAAATGGAGCTGGG - Intergenic
1064615222 10:17146542-17146564 CATACTAAAAATATGAAGCAGGG + Intronic
1066964625 10:42251562-42251584 CAACATAAACATACAGAGCTGGG + Intergenic
1067377406 10:45740648-45740670 GAACCTGAAATTATGTAGCTTGG + Intronic
1067768325 10:49106458-49106480 CAACCCCAAAATATGGCACTTGG + Intronic
1067885111 10:50081333-50081355 GAACCTGAAATTATGTAGCTTGG + Intronic
1068172415 10:53412386-53412408 AAACCTAAAAACTTGGAACTTGG - Intergenic
1068185617 10:53581873-53581895 CAACATATAAATATGGCGCAGGG - Intergenic
1068810532 10:61250884-61250906 CATCGTAAAAATTTAGAGCTGGG - Intergenic
1070150325 10:73801200-73801222 CAACCTAGAATTATGGAGCAGGG + Intronic
1073427908 10:103467229-103467251 CAACCTAAAAATATTACTCTAGG + Intergenic
1074312809 10:112336811-112336833 CTACCTACAAATATGCAACTTGG - Intergenic
1076893862 10:133299230-133299252 AAAACTAAACATATAGAGCTAGG + Intronic
1077944419 11:6879457-6879479 CAGCCTAGAAATATGCAGGTAGG - Intergenic
1080045214 11:27800870-27800892 AAACATAAAAATGTGGGGCTCGG - Intergenic
1081015613 11:37875938-37875960 AAAGTTAAAAACATGGAGCTGGG - Intergenic
1081197954 11:40184509-40184531 CAAGTTAGAAATATGGAGCCAGG + Intronic
1081612276 11:44569690-44569712 CAAGGTAAAAATAGGGAGGTAGG - Intronic
1086137519 11:83456861-83456883 CAACCCAAGAATTTGGGGCTGGG + Intronic
1086897727 11:92333086-92333108 ATACATAAAAATATGGTGCTTGG - Intergenic
1087726802 11:101727669-101727691 CATCCAAAAAATAAGGAACTTGG - Intronic
1094061954 12:26323748-26323770 CAACCAAAATGTATGCAGCTTGG + Intergenic
1096538870 12:52292019-52292041 CAACTGAAAAATCTGGAGATGGG - Intronic
1096542483 12:52315764-52315786 CAACTTGAAGATATGGATCTGGG + Intronic
1097379889 12:58882066-58882088 CAACCTAAAAATATATATCGTGG + Intronic
1097387755 12:58969923-58969945 CAAGTTAAAAAGATGAAGCTGGG + Intergenic
1098227691 12:68341654-68341676 CAACCTAAAGACATGTAGCAAGG - Intergenic
1106650864 13:31688532-31688554 CAACCTGGGAAAATGGAGCTTGG + Intergenic
1107343754 13:39437967-39437989 ATACCTAAAAATGTGGAACTGGG + Intronic
1107917711 13:45169153-45169175 CAACCTATGAATTTGGAGCAGGG - Intronic
1109100091 13:58172794-58172816 CAGCATAAGAATATAGAGCTGGG + Intergenic
1109775049 13:67029789-67029811 AAAACTAAAAATATTGAGTTGGG - Intronic
1112883774 13:104143427-104143449 AAACATAAAAATATCAAGCTGGG - Intergenic
1114130699 14:19788476-19788498 CAACATAAAATTGTGGAGCTCGG - Intronic
1115734585 14:36310879-36310901 CCAGCTAAAAATGTGGAGATTGG - Intronic
1118099180 14:62576516-62576538 CAACCTACTAAGATTGAGCTGGG + Intergenic
1118505383 14:66405253-66405275 CAACCTACAAGTATGGTGCTGGG + Intergenic
1119103430 14:71901700-71901722 CAACCCAAAAACAGGGAGATGGG - Intergenic
1119404231 14:74386739-74386761 CAACCTAAACTTCTGGACCTCGG + Intergenic
1120676104 14:87423197-87423219 CATCCTAAAAAAATGGATTTGGG - Intergenic
1123573756 15:21644112-21644134 CAACATAAAATTGTGGAGCTCGG - Intergenic
1123610374 15:22086697-22086719 CAACATAAAATTGTGGAGCTCGG - Intergenic
1125371974 15:38987525-38987547 TAACCTGAAAATATTTAGCTGGG - Intergenic
1126273179 15:46845709-46845731 TAACCTGAAAATGTGGAACTGGG - Intergenic
1126424181 15:48508004-48508026 CAAACTAAAAAAATGGTTCTTGG + Intronic
1127485840 15:59416902-59416924 CAACCTAAAAATATACAGGAAGG + Intronic
1128977857 15:72166619-72166641 CCACCTACAGGTATGGAGCTTGG - Exonic
1129115078 15:73361049-73361071 CAACATGAAAATATGGCTCTCGG - Intronic
1129526147 15:76215957-76215979 CCAACTAAATACATGGAGCTGGG + Exonic
1130574844 15:85082511-85082533 CAACCTAAAAATCTAGCCCTTGG - Intronic
1202982621 15_KI270727v1_random:378451-378473 CAACATAAAATTGTGGAGCTCGG - Intergenic
1132971371 16:2690893-2690915 CAACAAAAAAATATGGAACATGG - Intronic
1133030133 16:3006777-3006799 CAACATAAAAACAGGGAGATTGG - Intergenic
1133395594 16:5444674-5444696 CAAGGGAAAAATATGGGGCTGGG + Intergenic
1133672175 16:8033471-8033493 AAACTTAAAAATTTGTAGCTGGG + Intergenic
1133701407 16:8312703-8312725 CAATATAAAAATATGGATATAGG + Intergenic
1134283762 16:12841897-12841919 GAAACTAAAAATGTAGAGCTGGG + Intergenic
1137978062 16:53047694-53047716 CAACATATAAATTTGGAGGTAGG + Intergenic
1137986774 16:53115523-53115545 CAACCTAAAAATATGGAGCTGGG + Intronic
1140313225 16:73868826-73868848 TGACATAAAAATATGGAGCTTGG - Intergenic
1145229606 17:21163728-21163750 CACCCTAAGGATGTGGAGCTTGG - Intronic
1148671997 17:49417929-49417951 CAACCTACAAATATTGAACCAGG - Intronic
1149350877 17:55785835-55785857 TAACCTATAAATATGGAGCCTGG - Intronic
1149694375 17:58604930-58604952 CAACCTAAGAATAGGGACTTTGG + Intronic
1150593108 17:66580272-66580294 CTCCCTAAGAATGTGGAGCTAGG - Intronic
1151847393 17:76666828-76666850 CAACCTGAAAATATGCAGATTGG - Intergenic
1152849352 17:82623404-82623426 CAAACAAAAAAAATGGGGCTGGG + Intronic
1153023237 18:651007-651029 CAACCTCATAATTTGGACCTTGG + Intronic
1153321065 18:3774738-3774760 GTACCCCAAAATATGGAGCTCGG + Intronic
1155734160 18:29200460-29200482 CTACCTCAAAATATGGCACTTGG - Intergenic
1157031674 18:43917858-43917880 CCACCACAAAATATGCAGCTTGG - Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1159388240 18:67755140-67755162 CTAGCTAAAAATATGCATCTGGG - Intergenic
1161102528 19:2428321-2428343 CAACCTGCAAAAACGGAGCTGGG - Exonic
1161178866 19:2866235-2866257 TAACCTCAAAATATTGACCTAGG + Intergenic
1163396704 19:17067642-17067664 CAACATGAAAATTTGGAGCGTGG + Intronic
1164867438 19:31616451-31616473 CAAGATGAAAATATGGAGTTCGG + Intergenic
1165795794 19:38518462-38518484 CAACCTAGAAATCAGGAGCTGGG + Intronic
1167421506 19:49406673-49406695 CCATCTATAAAAATGGAGCTAGG - Intronic
925479523 2:4254543-4254565 CAATCTAAAAACATGCAGATTGG - Intergenic
925721592 2:6833631-6833653 CAACATAAGAATTTGGAGGTGGG + Intergenic
926914181 2:17877746-17877768 CAACTTAAAAATCTGCAGTTTGG + Intergenic
932000702 2:67881740-67881762 CAACCTAGAAATCTGGAATTCGG + Intergenic
932051569 2:68403571-68403593 CAACCTAGGAAGCTGGAGCTTGG - Intergenic
933321422 2:80780195-80780217 TAACCTCAAAATATATAGCTAGG - Intergenic
934079977 2:88459367-88459389 CAACTTATAAGTATGCAGCTGGG + Intergenic
934186625 2:89683605-89683627 CAACATAAACATACAGAGCTGGG + Intergenic
934315394 2:91913622-91913644 CAACATAAACATACAGAGCTGGG - Intergenic
938488372 2:131739596-131739618 AAACCTAAAATAGTGGAGCTGGG + Intronic
938676665 2:133642542-133642564 CACCCTAAAAAACTGGGGCTAGG + Intergenic
938777257 2:134552958-134552980 CAATTTAAAAATATGGATCAAGG - Intronic
939439726 2:142231465-142231487 CAACCTACCAATATTGAGCCAGG + Intergenic
941253214 2:163193855-163193877 CAACCTGAAAATATGAAAATAGG + Intergenic
942429166 2:175891448-175891470 CAATCTAAGAATATGTATCTTGG + Intergenic
945950299 2:216033224-216033246 CAACTTAAAAAAATGGAGGAAGG - Intronic
946224632 2:218257621-218257643 CAAGCTAAGGATAAGGAGCTTGG + Intergenic
947789910 2:232859424-232859446 CAACCAACAAAACTGGAGCTGGG - Intronic
1169086983 20:2832788-2832810 GAAATTAAAAATATGGAGGTAGG + Intergenic
1169710869 20:8561910-8561932 TCACCTAAAATTATAGAGCTAGG + Intronic
1169917732 20:10700158-10700180 CCACCTAGAGATAGGGAGCTAGG - Intergenic
1171211916 20:23323803-23323825 CAATCTAAAAAGAAGAAGCTGGG - Intergenic
1172245270 20:33441717-33441739 CCACCTAGAATTATGGAGCTGGG + Intronic
1173057216 20:39626629-39626651 AACCCTCAAAATATGGAGGTTGG - Intergenic
1173163662 20:40671118-40671140 CAACTTAGACAGATGGAGCTGGG - Intergenic
1174009360 20:47437149-47437171 AAAAATAAAAATATGGGGCTGGG + Intergenic
1174364164 20:50046462-50046484 TAGCCTCAAAATCTGGAGCTGGG + Intergenic
1176693833 21:9949754-9949776 TAACCTAAAGCTTTGGAGCTGGG + Intergenic
1177523592 21:22263993-22264015 CAAACAAAAAACATGGAGTTTGG + Intergenic
1178685768 21:34709519-34709541 AACCTTAATAATATGGAGCTTGG - Exonic
1178727433 21:35066482-35066504 CAACCTTAAAATATGGATGGAGG - Intronic
1178792940 21:35716960-35716982 AACCCTAAAAATATTGAGGTTGG + Intronic
1180542164 22:16459506-16459528 CAACATAAACATACAGAGCTGGG - Intergenic
1181339381 22:22165983-22166005 CTCCCTAAAAGAATGGAGCTGGG - Intergenic
959000171 3:100955149-100955171 CATGCTAGAAATATGCAGCTGGG - Intronic
959674555 3:109020075-109020097 CAAACTATAAATATGAAGTTAGG - Intronic
960230226 3:115217414-115217436 CAAAATAAAAAGATGTAGCTCGG + Intergenic
961128814 3:124446440-124446462 CAAACTCAAAACATAGAGCTTGG - Intronic
961796395 3:129411940-129411962 CAAACAAAAAATATAGAGCAGGG + Intronic
964053098 3:152419893-152419915 CAACCTGAGACTATCGAGCTTGG + Intronic
964337095 3:155667114-155667136 CAATTTAAAAATATGGATTTTGG - Intronic
965095629 3:164221250-164221272 AAACCTAAAAACAAGGACCTTGG + Intergenic
965298673 3:166981846-166981868 CAACAAAAAAATATGTTGCTTGG + Intergenic
966574886 3:181489255-181489277 CAACCTAAAAATCTGGAAAATGG + Intergenic
967341407 3:188402906-188402928 CAATATAAAAATATAGGGCTTGG + Intronic
967427775 3:189347235-189347257 CTAGGTAAAAATATGGAGTTGGG + Intergenic
970214531 4:13745229-13745251 CAACCTGGAACAATGGAGCTTGG - Intergenic
970310519 4:14777697-14777719 CAACCTAAAGAAAAGGAGTTGGG + Intergenic
970540715 4:17076013-17076035 CAACTTCAAAAAATGGAGTTGGG - Intergenic
971065292 4:23025153-23025175 CAAACTAAAAATATGGAAGTTGG + Intergenic
971747973 4:30609891-30609913 CAACCTAAATCTATGCTGCTTGG - Intergenic
972905913 4:43747004-43747026 AAACCCAAAAATTTGGTGCTGGG - Intergenic
977947632 4:102931703-102931725 CAACCTAAACATACAGAGCTGGG - Intronic
978100104 4:104828478-104828500 CAACCAAACAATATGGTGCTGGG - Intergenic
978693574 4:111546930-111546952 CAACTTAAAAATAAGAAGCTTGG + Intergenic
980081284 4:128346979-128347001 AAACTTAAAAATAGGGGGCTGGG - Intergenic
980366453 4:131809950-131809972 TAACCTAAAGCTTTGGAGCTGGG + Intergenic
981637810 4:146900076-146900098 CAACCTAAAAAAAGTGAACTAGG - Intronic
982945969 4:161622911-161622933 CAATCTATAAATATAAAGCTGGG + Intronic
984134226 4:175915655-175915677 CAACAAAAATATAAGGAGCTAGG + Intronic
984369578 4:178845583-178845605 TAACATAAAAAGATGGAGTTTGG + Intergenic
984457521 4:179988902-179988924 CACCCTGAAATTATGGATCTGGG - Intergenic
985120351 4:186634532-186634554 AAACCTAAAACCACGGAGCTAGG + Intronic
985299251 4:188470285-188470307 CAACCAAAAAATATAGAGCAGGG - Intergenic
985825120 5:2185784-2185806 CACCCTGAAAAGATGGAGGTGGG + Intergenic
987924656 5:24324944-24324966 CAACCTTAAAATATTGATGTTGG - Intergenic
988167839 5:27617164-27617186 CAACCTGAGATGATGGAGCTTGG - Intergenic
990025493 5:51182918-51182940 CAACAGAAAAATTAGGAGCTAGG - Intergenic
990439921 5:55834018-55834040 CAAAATGAAAATATGGGGCTTGG + Intergenic
992888321 5:81181163-81181185 CAACCTAATAATAAAGACCTGGG - Intronic
992957788 5:81928061-81928083 CAACGTAGAAATCTGGAGTTGGG + Intergenic
992963435 5:81977975-81977997 CAAAATAAAAATATGGCACTTGG + Intronic
997504874 5:134409328-134409350 GAACCTCAGAATATGGAGCTGGG - Intronic
998346803 5:141471352-141471374 CAAAATAAAAATAGGGGGCTTGG - Intronic
999001661 5:147930279-147930301 CAAACTGGAAATATGGAGCCTGG - Intergenic
1003833529 6:10041495-10041517 CCACCTTAAAATATGAAGATTGG + Intronic
1003941344 6:11030368-11030390 CAAGTTAAAAATAAGGATCTGGG - Intronic
1004643026 6:17533859-17533881 CAACTTAAAAAAATGAGGCTGGG - Intronic
1005525757 6:26646341-26646363 CAGGCTAAAAATAAGGAGGTGGG + Intronic
1005925351 6:30440154-30440176 TAACCTAAAAATAGGGAGTGTGG - Intergenic
1007313804 6:40968156-40968178 CAACATAACAAAATAGAGCTGGG - Intergenic
1009494797 6:64333311-64333333 CAATCAAAATATATGGAGATAGG - Intronic
1010673031 6:78709247-78709269 CAACATATGAATATGGAGCAGGG + Intergenic
1011242046 6:85282889-85282911 TAATCTAAAAATATGGACTTTGG - Intergenic
1013964908 6:115943720-115943742 TACCCTAAAAATATGGACATAGG - Intronic
1014598938 6:123384806-123384828 GAACTTAAAAATATAGTGCTTGG + Intronic
1014856547 6:126408692-126408714 CAACCTAACAATATTGAACCAGG - Intergenic
1014856989 6:126415020-126415042 CAACCTAACAAGATTGAGCCAGG + Intergenic
1015413917 6:132926989-132927011 CAGCTAAAATATATGGAGCTAGG - Intergenic
1024335161 7:48199549-48199571 CAACGTAAAAATTTGGGGATGGG + Intronic
1025976088 7:66371219-66371241 CAACCTAAAAAAATGAAACAGGG + Intronic
1032581761 7:133109874-133109896 CAAACTAAAAAAATGGAGACAGG + Intergenic
1032733453 7:134667410-134667432 CACTATAAAAATATTGAGCTGGG + Intronic
1036179278 8:6568926-6568948 CAGTCTAAAAAAATGAAGCTGGG + Intronic
1036287585 8:7457951-7457973 CAACCTAAATATAAGCATCTGGG - Intronic
1039410003 8:37345706-37345728 CAACCTAAAATTCTGTATCTAGG + Intergenic
1039508946 8:38073422-38073444 CATCCTGAAATTATGCAGCTGGG - Intergenic
1041416554 8:57616681-57616703 CAACCTAAAAATATGCAATAAGG + Intergenic
1041433363 8:57809306-57809328 AAACCTAAAATAGTGGAGCTGGG + Intergenic
1041679900 8:60577940-60577962 CAACTTAAAAATTTAGACCTTGG - Intronic
1042855946 8:73267624-73267646 AAACCTTAATAAATGGAGCTTGG + Intergenic
1043051676 8:75393308-75393330 CACCCAAAAAATGTGGAGTTTGG - Intergenic
1043340857 8:79237397-79237419 TAACTTAAAAATTGGGAGCTGGG - Intergenic
1044317381 8:90765530-90765552 CAACCTACATATATGGAACTTGG - Intronic
1044606290 8:94050978-94051000 CAACTTAAAATTAGGGGGCTGGG - Intergenic
1053630801 9:39935848-39935870 TAACCTAAAGCTTTGGAGCTGGG + Intergenic
1053774967 9:41527657-41527679 TAACCTAAAGCTTTGGAGCTGGG - Intergenic
1054213086 9:62314850-62314872 TAACCTAAAGCTTTGGAGCTGGG - Intergenic
1055204379 9:73710158-73710180 TAACCAAATAATATGGAGCTGGG - Intergenic
1057483818 9:95466458-95466480 CAACCGTAAACTATGGAGCCTGG + Intronic
1058394677 9:104537613-104537635 CAACTATAAAATATGGAACTTGG + Intergenic
1058634019 9:107019102-107019124 CTAAGTAAAAATATGCAGCTTGG + Intergenic
1060120729 9:120987164-120987186 AAACCTAGAAATATGGATCTAGG + Intronic
1061198813 9:129124362-129124384 CAACCTAAAAGTCTGAAGATGGG - Intronic
1185678405 X:1867597-1867619 CAATATGAAAATATGGGGCTGGG + Intergenic
1186328371 X:8505282-8505304 TAACTTAAAAATATGGACATTGG - Intergenic
1188684071 X:33047526-33047548 CAACCTAAAAATATGAAAGTAGG - Intronic
1188790931 X:34407569-34407591 CAACATTAAAATATGGAGGTGGG + Intergenic
1189480293 X:41387355-41387377 CAACCTAAAAGGAAGAAGCTGGG - Intergenic
1189599411 X:42606446-42606468 CAACCGAAAAGTTTGGAGCAGGG + Intergenic
1189663659 X:43330159-43330181 TAACCAGAAAATATGGAGCCTGG - Intergenic
1189984851 X:46544917-46544939 CAGACTAGAAATCTGGAGCTGGG - Intronic
1192431667 X:71116620-71116642 CAACAAAAAAATATTTAGCTGGG + Intergenic
1193079007 X:77386838-77386860 CAACCTATGAATATTGAGCCAGG + Intergenic
1193410983 X:81162619-81162641 CAACATAAAATTATGGGGCCAGG - Intronic
1194106998 X:89782282-89782304 CAACCTAAAAAAATTGAACTGGG + Intergenic
1195475371 X:105279168-105279190 CAACATAAAATTATGGAACTAGG + Intronic
1196824300 X:119728828-119728850 CGACCTAAAAAGAAGCAGCTTGG + Intergenic
1197370128 X:125615933-125615955 AAATCTAAAAATAGAGAGCTTGG - Intergenic
1197601442 X:128535632-128535654 CAAACCCAAAAGATGGAGCTTGG - Intergenic
1199963656 X:152800228-152800250 CAACCTAATTATATGGAGAGAGG + Intergenic
1200458958 Y:3430142-3430164 CAACCTAAAAAAATTGAACTGGG + Intergenic
1201183059 Y:11368441-11368463 CAACATAAACATACAGAGCTGGG - Intergenic
1201800721 Y:17952266-17952288 TGACCCAAAAATATGAAGCTAGG + Intergenic