ID: 1137991201

View in Genome Browser
Species Human (GRCh38)
Location 16:53157650-53157672
Sequence AAATATGTATGTTCACTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 378}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137991201 Original CRISPR AAATATGTATGTTCACTTAA TGG (reversed) Intronic
900891310 1:5451618-5451640 AAATGTGTATTTTTACTTGAAGG + Intergenic
901721072 1:11198109-11198131 AACTAAGTATGATCACTTTAAGG - Intronic
902355184 1:15893179-15893201 AAATATGTCTGTTTACATACTGG + Intronic
905001511 1:34673955-34673977 AAATATGTATGAAAACTTTATGG - Intergenic
905003059 1:34688568-34688590 AAGTATGCATGTTCCCATAAGGG + Intergenic
906339886 1:44970153-44970175 AGTTATGTTTTTTCACTTAAAGG - Intronic
908559265 1:65288874-65288896 AAATTAGTATATTCCCTTAATGG - Intronic
909598898 1:77440616-77440638 AAAAATATTTGTTCACTTAATGG + Intronic
909781450 1:79552413-79552435 AATTATTTATTTTCACTTATCGG + Intergenic
910639672 1:89446352-89446374 GACTATCTATGTTCACTTAAGGG + Intergenic
910856789 1:91703926-91703948 AAAAATGTCTGTTCACCCAAAGG - Intronic
910975301 1:92900243-92900265 ACAAATATTTGTTCACTTAATGG + Intronic
911398746 1:97347262-97347284 AAATATCTTTGATCACTTTAAGG + Intronic
911429253 1:97762538-97762560 AAATATAAAGGTTGACTTAATGG - Intronic
911602287 1:99858861-99858883 AAATATAAAAGTTAACTTAATGG - Intronic
911925040 1:103818667-103818689 TCATATATTTGTTCACTTAATGG - Intergenic
914828153 1:151150669-151150691 AAATATGTATTTTTAATGAATGG + Intergenic
916957303 1:169852162-169852184 CAATATGTAACTTCCCTTAAAGG - Intronic
917320985 1:173781116-173781138 AAAAATGTATGTTATCTTCAGGG + Intronic
918335715 1:183510399-183510421 AAATATGTATTTTTTTTTAATGG + Intronic
919262283 1:195211714-195211736 AAAGATAGATGTTAACTTAAAGG + Intergenic
919540390 1:198838109-198838131 AAATTTCTATGTTTACTTTAAGG - Intergenic
919551742 1:198998895-198998917 AAATATTAATATCCACTTAAAGG - Intergenic
920582931 1:207129300-207129322 ACATATGTTGGTACACTTAATGG - Intronic
920722082 1:208397253-208397275 AAAAATGTCTGTTCCCTTTATGG + Intergenic
922547860 1:226472016-226472038 AAATATTTATGTTCATATAATGG + Intergenic
924833142 1:247619269-247619291 AAATATGTATATTCAGTTGATGG + Intergenic
1062827106 10:579538-579560 ACCTATGTATGTACACTTTATGG - Intronic
1062885775 10:1015171-1015193 AAATATTCTTATTCACTTAACGG - Intronic
1063154481 10:3366039-3366061 AATCAGGTATGTTCCCTTAAGGG - Intergenic
1063391921 10:5655411-5655433 AAATAGGTAGATGCACTTAAAGG + Intronic
1063892389 10:10643761-10643783 AAATATTGATGTTCACTTTCAGG - Intergenic
1065419866 10:25531137-25531159 AAAAATATATGTTATCTTAAAGG - Intronic
1066956852 10:42181362-42181384 ATACATGTATGTACACTTCATGG + Intergenic
1067075506 10:43178249-43178271 AAATATGTATATTTACATAAGGG - Intronic
1067246028 10:44545338-44545360 AAATCTGTATGCTAATTTAAGGG + Intergenic
1068572655 10:58647790-58647812 AAATGTGTATAATCACGTAAAGG + Intronic
1068608817 10:59036013-59036035 AAATATGAATGGTCTCTAAATGG - Intergenic
1068663174 10:59645388-59645410 ACAAATATTTGTTCACTTAATGG + Intergenic
1072495889 10:95958764-95958786 GAATATGTTGGTCCACTTAATGG - Intronic
1073537235 10:104288687-104288709 AAATTTGTCTGTTCAGTTCAGGG + Intronic
1073675316 10:105640119-105640141 AAATATTTATATTCATTTATGGG + Intergenic
1074096427 10:110317730-110317752 AAATATGTAAGTTCAATACAAGG + Intergenic
1077699721 11:4430396-4430418 AAATATGCAGGTCCACTTATAGG + Intergenic
1077864777 11:6212994-6213016 AATTAAGTATGTTGAGTTAAGGG - Intronic
1078747907 11:14132733-14132755 AAATATGTATGATAAGATAATGG - Intronic
1081099424 11:38983561-38983583 AAATGTATGTTTTCACTTAATGG - Intergenic
1081475787 11:43429544-43429566 ATATATTTTTGTTCACTTCATGG + Intronic
1081510495 11:43767498-43767520 AAATATTTAACTTCACTTGATGG - Intronic
1085540094 11:77259504-77259526 AAATAACTATTTTCAGTTAATGG + Intronic
1085928158 11:81047278-81047300 AAATATGTATTTGGATTTAAAGG - Intergenic
1086536710 11:87855799-87855821 AATTATTTATGTTTATTTAAAGG - Intergenic
1086975861 11:93132060-93132082 ATATCTTTCTGTTCACTTAATGG - Intergenic
1087449860 11:98307135-98307157 AAATATATATATTCACAGAATGG + Intergenic
1087551329 11:99654051-99654073 AAATATTTATCATCACTGAAGGG - Intronic
1088080493 11:105906284-105906306 AAATATGTTTTCTCACTTACAGG - Intronic
1088922907 11:114274465-114274487 AAATATGTATGTGAGCTTGAAGG + Intronic
1089551236 11:119280140-119280162 CAATATGAATGTTCATTAAAAGG - Intronic
1090231530 11:125110454-125110476 AGATGTGTGTGTTCATTTAATGG + Intronic
1090683848 11:129093247-129093269 ATAAAAGTATTTTCACTTAAGGG + Intronic
1091568985 12:1668100-1668122 AAAAATGTGAGTGCACTTAATGG + Intergenic
1092767612 12:11867692-11867714 ATATATGTATATTATCTTAATGG + Intronic
1093100378 12:15021057-15021079 AAATATTTATTTTCAGGTAATGG + Intergenic
1093292351 12:17343421-17343443 AAATATGTTGGTACACTTGATGG + Intergenic
1093327501 12:17795739-17795761 AATTTTCTATGTTCACTTGAGGG - Intergenic
1094211250 12:27894765-27894787 GCAAATGTTTGTTCACTTAATGG + Intergenic
1094310727 12:29078445-29078467 AAATCTGTATTTCCATTTAAGGG - Intergenic
1094435542 12:30417077-30417099 ACATATGTGTGTAAACTTAAAGG + Intergenic
1095568676 12:43656844-43656866 ATATATGTCTGTTCAGTAAAGGG + Intergenic
1095738601 12:45584845-45584867 TCATATGAATGTTCACTGAAGGG + Intergenic
1097508299 12:60504376-60504398 AAATATGTTTGGTCACTAAGTGG + Intergenic
1097647827 12:62258408-62258430 AAAAATGCATTTTCTCTTAAGGG + Intronic
1097867690 12:64572838-64572860 AAAAATAGATGTTCAATTAATGG - Intergenic
1098808868 12:75058506-75058528 AAATATTTGTTTTTACTTAATGG + Intronic
1099185972 12:79515753-79515775 TAATCTGTCTTTTCACTTAATGG + Intergenic
1099470699 12:83044235-83044257 ATAAATGTATGTTCAATGAAAGG - Intronic
1100148454 12:91706644-91706666 AAATATCTATGTTTACTTTCAGG + Intergenic
1100235304 12:92654715-92654737 TAATATTCATGTTCACTTCAAGG + Intergenic
1100491293 12:95081303-95081325 AAATTTTGATGTTTACTTAATGG - Exonic
1100731669 12:97477676-97477698 AAGTATGTTTGTTCCCTTAAAGG - Intergenic
1101180729 12:102214346-102214368 ACATATGAATGTTCCCTAAAAGG + Intergenic
1101204953 12:102477314-102477336 AAATATAAATATTCAGTTAATGG + Intronic
1101749213 12:107569483-107569505 AATTGTTTTTGTTCACTTAAAGG - Intronic
1102746644 12:115254913-115254935 AAAAATGTTTGTTGACTTAAAGG + Intergenic
1102783209 12:115583496-115583518 ATCTATATTTGTTCACTTAATGG - Intergenic
1104049938 12:125188120-125188142 AAATATTTTGGGTCACTTAAGGG - Intronic
1104338132 12:127920021-127920043 AAATGTGTATATTCACATAGAGG - Intergenic
1106369200 13:29114829-29114851 AAATTTGTATTTTCAATTAAGGG + Intronic
1106624039 13:31401361-31401383 CAATCTGTGTGTTTACTTAAAGG + Intergenic
1106962191 13:35011738-35011760 AGGTATGTATGTTCATTTCAGGG + Intronic
1107106693 13:36650904-36650926 AAATTTGAATTTTCACTTGAAGG - Intergenic
1107306614 13:39027502-39027524 TAATATGCATGTTGCCTTAAAGG + Intronic
1107915764 13:45148627-45148649 AAATTTTAATGTTCAATTAAGGG - Intronic
1108234344 13:48387269-48387291 AATTATTTATGTTAACATAATGG + Intronic
1108824981 13:54402252-54402274 ACATATGAATGTACACATAAAGG - Intergenic
1108840915 13:54613891-54613913 AATTATCTATGTTTACTTAAAGG - Intergenic
1109106205 13:58253575-58253597 CAATATGAATGTTATCTTAAGGG - Intergenic
1109294987 13:60519498-60519520 ATACATGTATTTTCATTTAATGG + Intronic
1109552643 13:63924191-63924213 ATATATGTATATTCAATTACGGG - Intergenic
1110932799 13:81243637-81243659 AAATATGAATGTTCACTCCAAGG - Intergenic
1111342502 13:86905619-86905641 AGATAAGTATTTTCACATAAAGG - Intergenic
1111735873 13:92138603-92138625 ATTTGTGTATGTTCGCTTAAGGG + Intronic
1111771531 13:92602496-92602518 AAATCTGCATGATCACTAAAGGG + Intronic
1112641179 13:101276840-101276862 AAATATGTATGTGCACATGTGGG + Intronic
1112828140 13:103415935-103415957 ATATATGTATGTGTACATAAAGG + Intergenic
1114129532 14:19774207-19774229 AAATATGTATTTTAACAAAAAGG + Intronic
1116267170 14:42707631-42707653 TAAAATGTATGTGCACCTAAAGG - Intergenic
1116353781 14:43901208-43901230 AAATATAAATACTCACTTAACGG - Intergenic
1117171521 14:53104893-53104915 AAATATGTATGTACAAATGACGG - Intronic
1117282300 14:54253174-54253196 AAATATGTTTTTCCAGTTAATGG - Intergenic
1117949457 14:61067266-61067288 AAATATGTAATCTCACTTGAAGG - Intronic
1118014538 14:61645278-61645300 AAACATCTGTGTTCCCTTAAAGG - Intronic
1118520702 14:66581659-66581681 CAATCTGTATGTGCCCTTAAAGG - Intronic
1118865581 14:69701036-69701058 AAATATATGTGTGCACTTAATGG + Intronic
1119075718 14:71636477-71636499 AAAAATGTATGTAAACTGAATGG + Intronic
1119855304 14:77895824-77895846 AATTATGTATGTTCATTTTCTGG + Intronic
1119856662 14:77906181-77906203 AAATAGGTCTGTTGACTTGAGGG + Intronic
1122766868 14:104078440-104078462 AAAAATAAATGTTCAGTTAAAGG - Intergenic
1202936261 14_KI270725v1_random:90418-90440 ATACATGTATGTACACTTCATGG - Intergenic
1123572817 15:21631967-21631989 AAATATGTATTTTAACAAAAAGG + Intergenic
1123609438 15:22074554-22074576 AAATATGTATTTTAACAAAAAGG + Intergenic
1123675489 15:22707241-22707263 ATTTGTGTATGTTCACTTAAGGG + Intergenic
1124327482 15:28780179-28780201 ATTTGTGTATGTTCGCTTAAGGG + Intergenic
1124644874 15:31431397-31431419 AAAAATGTATATTCATATAATGG + Intronic
1124769165 15:32515498-32515520 ATTTGTGTATGTTCGCTTAAGGG - Intergenic
1124905347 15:33862984-33863006 TAAGATGTATATTCTCTTAATGG - Intronic
1126403780 15:48301889-48301911 ATGTATGTTTGTTTACTTAAAGG + Intronic
1127324768 15:57884258-57884280 AAATATGCAAGTTCAGTGAAAGG + Intergenic
1127349147 15:58132548-58132570 AATAATGTATCTTAACTTAAAGG + Intronic
1128005896 15:64240303-64240325 ATGCATGTTTGTTCACTTAATGG - Intronic
1128514064 15:68331336-68331358 TAACATGTATTTACACTTAATGG - Intronic
1128658733 15:69482551-69482573 ACATATGTATCTTCACTCCAGGG - Intergenic
1130717985 15:86355227-86355249 ACATATTTATGTTTACATAAAGG + Intronic
1131699840 15:94922501-94922523 AAATGTTTATCTTCACTTAATGG + Intergenic
1131989396 15:98078650-98078672 AAATTAGTATTTTCAATTAAAGG + Intergenic
1202981678 15_KI270727v1_random:366339-366361 AAATATGTATTTTAACAAAAAGG + Intergenic
1133367806 16:5224851-5224873 AAAAATGTATGTTGAATGAATGG - Intergenic
1133674205 16:8054876-8054898 AAATATGTTTGTTTTTTTAATGG - Intergenic
1133984038 16:10654394-10654416 AATTGTATATGTTAACTTAAAGG + Intronic
1137991201 16:53157650-53157672 AAATATGTATGTTCACTTAATGG - Intronic
1138854754 16:60676560-60676582 AAATATCTATTATCTCTTAATGG + Intergenic
1139087971 16:63611955-63611977 ATATCTGTAGGTTCATTTAATGG + Intergenic
1139314975 16:66060171-66060193 AAATATTTATGTGAACTTCAAGG - Intergenic
1139333967 16:66217858-66217880 ATTTATGTATATTAACTTAATGG - Intergenic
1144801143 17:17928469-17928491 AAAAATGCATGCTCACATAATGG + Intronic
1151918492 17:77136616-77136638 AAGTATGTATGTTTGCTTATGGG + Intronic
1152592528 17:81220799-81220821 AAATGTGTATTTTTACTTAGGGG - Intronic
1153755396 18:8277521-8277543 AAATATGTGTGATCACATAAAGG + Intronic
1153916552 18:9750756-9750778 AAGTATGTTTCTTCACTTAGTGG - Intronic
1154063247 18:11083310-11083332 AAATATTTGTATTCACTTAGAGG + Intronic
1154372655 18:13778759-13778781 AAAAATATATGTTAAGTTAATGG - Intergenic
1155709874 18:28863098-28863120 ACATATGTATAATCACTTAAAGG + Intergenic
1155797514 18:30059080-30059102 AAATGTGTTTGAACACTTAAAGG + Intergenic
1156411795 18:36836292-36836314 AAAAATGTTTTTTCACATAATGG + Intronic
1156911502 18:42416318-42416340 AAATGTGTATCTATACTTAATGG - Intergenic
1157017374 18:43733374-43733396 AAATATGTATCTTTTCTGAAAGG + Intergenic
1157776245 18:50398713-50398735 AAATATGTTGGTGCACTTAATGG + Intergenic
1157977006 18:52339415-52339437 AAATATGATGGTTCACGTAATGG - Intergenic
1158818553 18:61131794-61131816 AAATATGTATGTTTGTTAAATGG + Intergenic
1159411534 18:68082275-68082297 AAATATGTAGACTCACTTAATGG + Intergenic
1159552138 18:69906240-69906262 AAATATGTAAGTTCACATCTAGG - Intronic
1159992349 18:74923980-74924002 AAAGTTGTATATTCACATAATGG + Intronic
1164622639 19:29706277-29706299 AAATATTGATGTTCTCATAAAGG - Intronic
1164796112 19:31032137-31032159 AAATATTTGTGATCACTGAATGG + Intergenic
1165466144 19:35976241-35976263 CAATATGTATGTTCATTTTTTGG + Intergenic
1167956211 19:53066238-53066260 TACTATGTATTTTCACTTCATGG + Intergenic
925739039 2:6989163-6989185 ACATATGTATGTACACTAACCGG + Intronic
926412839 2:12622583-12622605 AAATATAAATATACACTTAAAGG + Intergenic
926678257 2:15644901-15644923 AAATGTATTTGTTCACATAATGG + Intergenic
927531485 2:23808226-23808248 AAATATATATATTTACTTTAGGG + Intronic
927802623 2:26115372-26115394 AAATGTGTATATTCATATAAGGG + Intronic
929511791 2:42570538-42570560 AAATATTTATTTTCCCTTGATGG + Intronic
929653815 2:43708958-43708980 AAATATGTATTAACATTTAAGGG - Intronic
930591928 2:53337942-53337964 AAATTTGTATGGAGACTTAAGGG - Intergenic
931087831 2:58853251-58853273 AAAAATGTATGTTTATGTAAAGG - Intergenic
931129695 2:59321115-59321137 AAATATTTATGTTCAAATATTGG + Intergenic
932728080 2:74197209-74197231 ATATATGTGTGTTCCCTTACTGG + Intergenic
933207594 2:79526360-79526382 ATATATGTATGTTCACAAATGGG + Intronic
933360472 2:81276534-81276556 AATCATGTACTTTCACTTAATGG - Intergenic
934247434 2:90319760-90319782 ATACATGTATGTACACTTCATGG - Intergenic
934261891 2:91482843-91482865 ATACATGTATGTACACTTCATGG + Intergenic
934304932 2:91813832-91813854 ATACATGTATGTACACTTCATGG + Intergenic
934328325 2:92038916-92038938 ATACATGTATGTACACTTCATGG - Intergenic
934466703 2:94269457-94269479 ATACATGTATGTACACTTCATGG - Intergenic
934873077 2:97885908-97885930 TAATATATTTGTTCACTTCATGG + Intronic
934878519 2:97951153-97951175 AAATCCTTATTTTCACTTAAAGG - Intronic
936022744 2:109007198-109007220 AAATATGTGTTTTAAGTTAAAGG + Intergenic
936341531 2:111637993-111638015 AAATCTGAATCTTGACTTAAAGG + Intergenic
936739601 2:115489681-115489703 AAATATGTTTGTTTCCTTCAGGG - Intronic
937800773 2:126077992-126078014 ATATTTGTATGCTCACTAAAGGG + Intergenic
938403103 2:131010462-131010484 AAATATTTATTTTCTCTTAAGGG - Intronic
939513354 2:143134992-143135014 AAATATGAATGTTCAAGTGAAGG + Intronic
939775443 2:146381349-146381371 ATATATTTATGTTGAATTAATGG + Intergenic
940361493 2:152800690-152800712 TAATAAGTATTTTCAATTAAAGG + Intergenic
940416553 2:153429033-153429055 TAATATATATGGACACTTAATGG - Intergenic
940628476 2:156207493-156207515 AAACATTTCTGTTCACTTAATGG - Intergenic
940697440 2:156997235-156997257 AAATAAGCATGTTCTCTTTAAGG + Intergenic
941132199 2:161666048-161666070 GAATATATATGTTCACTTATAGG - Intronic
941191552 2:162390195-162390217 ATTTATGTATGTTTACTTACAGG - Intronic
941705597 2:168655505-168655527 AAATGTGTATGTACACACAATGG + Intronic
942978374 2:182047548-182047570 AAATAAGTTGGTTCACTTAATGG - Intronic
943004546 2:182373586-182373608 AAATTTGAATGTTTACTTTAAGG - Intronic
943224802 2:185158341-185158363 ATATATATATGTACACTAAAGGG + Intergenic
944158891 2:196638783-196638805 GAATATGTATTCTCACTTAAGGG - Intergenic
945032025 2:205674541-205674563 AAATATGTAATTTAACTTTAGGG + Intergenic
945906353 2:215598002-215598024 AAAATTGTATGTTCACCTATTGG + Intergenic
946865919 2:224040457-224040479 AAATATTTATATTCAGTTACAGG + Intergenic
947010101 2:225556214-225556236 AAATGTTTATGTCCACTTAAGGG - Intronic
947303674 2:228719095-228719117 AAATATTTAAGTTCATTTTAAGG - Intergenic
1169582450 20:7039204-7039226 AATTCTATATGTTTACTTAAGGG - Intergenic
1169750019 20:8982027-8982049 AAATATCTAGGTTCACTAAGGGG - Intergenic
1170430886 20:16275415-16275437 AAATATTTATCTTGATTTAATGG - Intronic
1172470882 20:35194384-35194406 AAGTATGTTTGTACACTTACAGG + Intergenic
1172814952 20:37678946-37678968 AAAAATGTATGTTCTTTTTAGGG - Intergenic
1173051813 20:39570619-39570641 ACAAATATTTGTTCACTTAATGG + Intergenic
1173153831 20:40590911-40590933 AAAACTGTATGTTTACTAAAGGG - Intergenic
1174978163 20:55358898-55358920 AAATATGTATTTTGACACAAAGG + Intergenic
1175528662 20:59657939-59657961 ACATATGTTGGTCCACTTAATGG + Intronic
1175624349 20:60478010-60478032 AAACATTTATATTCACTTTATGG + Intergenic
1177058983 21:16347497-16347519 CAATATGAATGCTCACTCAAAGG - Intergenic
1178022974 21:28431004-28431026 AAATATGGATATTTACCTAAAGG - Intergenic
1180280613 22:10690094-10690116 ATACATGTATGTACACTTCATGG - Intergenic
1180587835 22:16908632-16908654 ATACATGTATGTACACTTCATGG - Intergenic
1184907916 22:47502347-47502369 AAATAAGTATGATTACTGAAAGG + Intergenic
949654067 3:6196738-6196760 ACATATGTATGTACACCCAAAGG + Intergenic
949713171 3:6895864-6895886 AAATATATATTTTTACTCAATGG - Intronic
951401295 3:22234623-22234645 CATTATTTATGTTTACTTAAGGG + Intronic
951754920 3:26080187-26080209 AAATATGTATGTAATATTAAAGG + Intergenic
953058360 3:39406239-39406261 AGATTTAAATGTTCACTTAAGGG - Intergenic
953239881 3:41139336-41139358 AAATGTGTATGTTCACCTGTGGG + Intergenic
953788135 3:45926430-45926452 AAATATGTCAGTTCATTAAAAGG + Intronic
953830251 3:46291011-46291033 AAATATGTATGTTGTATCAAGGG + Intergenic
955020881 3:55119954-55119976 TAAAATGTTTTTTCACTTAATGG + Intergenic
955611962 3:60767229-60767251 GAATCTGTATGTTGTCTTAATGG + Intronic
956681217 3:71784025-71784047 AAATATTTAAGTGCACATAATGG - Intronic
957179085 3:76852911-76852933 AATTATGTATATTTTCTTAAGGG - Intronic
957917232 3:86701420-86701442 GAATATCGATATTCACTTAAAGG - Intergenic
958159618 3:89800636-89800658 AAAAATGTATGTTTAGTAAAGGG + Intergenic
958509321 3:95025512-95025534 AAATATGTATGTTAAATTCTGGG - Intergenic
959509332 3:107192042-107192064 AAGTAGATATGTTCACATAAAGG + Intergenic
960200426 3:114828267-114828289 AAATATGTATGTGCAATAAAGGG - Intronic
960448115 3:117773087-117773109 ATATATGTATGTACACATACAGG + Intergenic
960562364 3:119098689-119098711 AAATATGTTTTTTAAATTAATGG + Intronic
960692636 3:120362959-120362981 AAATGTGTTTGATCACTTTATGG - Intergenic
961259190 3:125586493-125586515 AAATATGTATGTTATAGTAATGG - Intronic
961829000 3:129613726-129613748 AAATAGGTATGTTCACGGTAGGG - Intergenic
961939055 3:130618390-130618412 AAATATGAATGCTCAATAAAAGG + Intronic
962170079 3:133092704-133092726 AAGGAGTTATGTTCACTTAATGG - Intronic
962256595 3:133874152-133874174 AACTATGCATATCCACTTAAAGG - Intronic
963559519 3:146845246-146845268 AAATTTCTATGTTCACTTTTTGG + Intergenic
964121481 3:153188946-153188968 AAATATGTATCTCCACTGAAGGG + Intergenic
964223800 3:154373908-154373930 ACAAATGTTTGTTCAATTAATGG + Intronic
964583549 3:158268947-158268969 AATTATGTATTTTCAATGAAAGG - Intronic
966636385 3:182138898-182138920 AAATTTTTATGTTCACTTTTTGG + Intergenic
966995510 3:185276212-185276234 AAATATGTATTCTCACAAAAGGG - Intronic
970522043 4:16895140-16895162 AAATCTGAATTTTCAATTAAAGG + Intronic
970664779 4:18324315-18324337 CACTATGGATGTTCACATAATGG - Intergenic
971220679 4:24703282-24703304 ATTAAGGTATGTTCACTTAATGG - Intergenic
971442440 4:26702165-26702187 AAAAATGAATGCTCCCTTAAGGG - Intronic
971628353 4:28954660-28954682 AAAAATGTATGTTAATTTACGGG + Intergenic
972076630 4:35098259-35098281 AAATATTTATGTTCACATCTGGG - Intergenic
972975004 4:44623606-44623628 AAATATGTTTGTTTTATTAATGG - Intronic
974986428 4:69032802-69032824 AAATATGTATATTCTCATCATGG - Intronic
975373696 4:73617635-73617657 TAATAAGGATGTTAACTTAAAGG - Intronic
976434062 4:84996548-84996570 AAATAATTATATTCACTTCAAGG + Intergenic
976997898 4:91458943-91458965 AAATATTTATGATAACCTAAAGG - Intronic
977024889 4:91805395-91805417 ATATATGTATGTTGACTGGAAGG - Intergenic
977315114 4:95436955-95436977 AAAAATCTATGTTCGATTAAAGG - Intronic
977941633 4:102865871-102865893 AAATATGTAAATACAGTTAAAGG - Intronic
977954966 4:103016350-103016372 AAATATGTATGGTCAAAGAAGGG - Intronic
980463509 4:133147886-133147908 AAATATATATTTTTAATTAATGG - Intergenic
980601767 4:135036323-135036345 AAATATATATGTACATATAAAGG - Intergenic
980656097 4:135788584-135788606 AGATATGTATCTTCAAGTAAAGG + Intergenic
980961011 4:139475679-139475701 AATTATTTATTTTCAATTAAAGG - Exonic
982288171 4:153756361-153756383 AAACAAGTATGTTCACTTTAGGG - Intronic
982403112 4:154990436-154990458 AAATATGGATTTTCACCTATGGG - Intergenic
983023173 4:162704985-162705007 AAATGTGTAAGTTCACATAGAGG + Intergenic
983168406 4:164507591-164507613 AAATATGTATTTACAGATAATGG + Intergenic
983933222 4:173475848-173475870 AAATATGTAACTCCACTTATAGG + Intergenic
984101030 4:175485841-175485863 GAATATGTTGATTCACTTAATGG - Intergenic
984670496 4:182479774-182479796 AAATATTTTTGATCTCTTAATGG + Intronic
985526939 5:409308-409330 AAATGGGTATGTTCACAAAAAGG - Intronic
986389479 5:7270879-7270901 AAATATGTACAAGCACTTAATGG + Intergenic
986851446 5:11817952-11817974 TAATACGTATCTTCACTTCATGG - Intronic
987839785 5:23208707-23208729 AATTATGTTTGTTTACTTATAGG + Intergenic
988059131 5:26144061-26144083 GAATCTGTCTGCTCACTTAAAGG - Intergenic
988412312 5:30902484-30902506 AATGGTGTATGTCCACTTAAAGG + Intergenic
988419967 5:30993455-30993477 TAACATGTATATTCATTTAAAGG + Intergenic
988622868 5:32841546-32841568 AAATAGTTTTGTTCACTTATGGG - Intergenic
989421369 5:41242776-41242798 AAAAAAGTATGTACACTCAATGG + Intronic
990333730 5:54752157-54752179 ATATATTTATTTCCACTTAAAGG + Intergenic
990738245 5:58887455-58887477 AAATGTGTGTGTTCTCTTTAGGG + Intergenic
992575921 5:78112041-78112063 AAATATTTATGATTACTAAAGGG + Intronic
993186791 5:84632130-84632152 AAATATGTATATTTAATCAATGG + Intergenic
993738916 5:91512289-91512311 TAATATTAATGTTCACTTACAGG - Intergenic
994075895 5:95649376-95649398 AAATGTGTATGTTCATTCAATGG - Intronic
994275844 5:97836429-97836451 AAAAATGTATGTTAAATGAATGG + Intergenic
994326298 5:98449862-98449884 AATTAAATATGTTCATTTAATGG + Intergenic
994596621 5:101846171-101846193 AAATATGTATTTCCACGTTAGGG - Intergenic
995078605 5:108017827-108017849 AAATATCTATGTTCAGTTTGGGG + Intronic
995989951 5:118225894-118225916 AAATACGTATGCTTACTAAACGG + Intergenic
996038158 5:118781624-118781646 AAAAGTGCATGTTCACTTTATGG - Intergenic
997489296 5:134259762-134259784 ACATATGCATGTACCCTTAAAGG - Intergenic
999136975 5:149327799-149327821 ACATATGTTTGTGCACTTAATGG - Intronic
1001178326 5:169493964-169493986 GAACATCCATGTTCACTTAATGG - Intergenic
1006975103 6:38092880-38092902 AAAGATGTGTATTTACTTAAAGG - Intronic
1008300127 6:49827098-49827120 AAAAATGCAGGTTCACTTAGTGG + Intergenic
1009246101 6:61239604-61239626 AAATATGTCTGATCATTAAAGGG + Intergenic
1009273527 6:61645926-61645948 AAATATATGTGTTTACTAAAAGG - Intergenic
1009860201 6:69320001-69320023 AAATCTATCTGTTCAATTAAAGG - Intronic
1010578879 6:77568925-77568947 GTATATGTATGTTCAATGAATGG - Intergenic
1010830897 6:80527750-80527772 AAATCTGTATTTACACATAAAGG - Intergenic
1012900153 6:104995733-104995755 AAATATATATGTGCGTTTAATGG + Intronic
1013766144 6:113576621-113576643 AAATATGGAACTTCACTTAAAGG - Intergenic
1014445929 6:121527411-121527433 AAGTAAATATTTTCACTTAAAGG + Intergenic
1014585818 6:123196469-123196491 TTATAAGTATATTCACTTAATGG - Intergenic
1014633049 6:123811066-123811088 GAATATGTGTCTTCACCTAATGG + Intronic
1015073690 6:129129369-129129391 AAATTTGTATTTTTACTTGAAGG + Intronic
1015209012 6:130675020-130675042 AAATATGTTTCTTCTATTAATGG + Intergenic
1015261765 6:131246109-131246131 ATATATATATGTTCAGTTATAGG + Intronic
1015404542 6:132822276-132822298 TAAAATATATGTTTACTTAATGG + Intergenic
1016030886 6:139336697-139336719 AAATGAGTATTTTCAGTTAAGGG + Intergenic
1016131123 6:140472596-140472618 AAGTAAGTATCATCACTTAAAGG + Intergenic
1016146577 6:140684086-140684108 CAATGTGTATGTTCATTTCAGGG - Intergenic
1017473061 6:154759301-154759323 AAATTTGTGTGTTGAATTAAAGG + Intronic
1018027206 6:159815876-159815898 AAAAATTTATATTAACTTAAGGG + Intronic
1019800853 7:3087352-3087374 AAATCTGTATCTTCACTTGCTGG + Intergenic
1020341893 7:7120513-7120535 AATTATATATGTTGACTAAATGG - Intergenic
1022598267 7:31733094-31733116 AAATATGTATGTGCCCTTTAGGG - Intergenic
1022651934 7:32285479-32285501 AAATGTATATGTTCACATAATGG + Intronic
1024058799 7:45683160-45683182 CCATATGAATGTTCACTAAAGGG - Intronic
1024731320 7:52256698-52256720 AAATATTTATGTTCTATAAATGG - Intergenic
1025028533 7:55537214-55537236 AAATATGTGTGTTCAGCTGAAGG - Intronic
1026209142 7:68287828-68287850 ATCTATGTAAGTTCACTTTAAGG - Intergenic
1026871467 7:73855408-73855430 AAATATGTCTGTATACTTATTGG - Intergenic
1027829292 7:83156533-83156555 AAACTTTTATGATCACTTAAAGG - Intronic
1028413182 7:90552899-90552921 AAATATGTATTTACATTTGAAGG - Intronic
1028558919 7:92152085-92152107 AAATATGATTATTCACTAAAAGG - Intronic
1028837912 7:95395634-95395656 GAATGTGTATTATCACTTAAAGG + Intronic
1029593355 7:101522086-101522108 GAATAAATATGTTCACTGAAAGG - Intronic
1030863241 7:114664192-114664214 AAACATGTATCTTCTTTTAATGG - Intronic
1030892279 7:115013594-115013616 TAATATGGATATTCACTTGAAGG + Intronic
1030925664 7:115450818-115450840 AAATAAATATTTTCCCTTAAAGG - Intergenic
1030956066 7:115854354-115854376 TAATTTATATTTTCACTTAAAGG - Intergenic
1031204213 7:118733707-118733729 AATTATATTTGTTCATTTAATGG - Intergenic
1031405786 7:121385167-121385189 ATATAAGTATGTTCATTAAAAGG + Intronic
1031492984 7:122411795-122411817 AAATATTTAAGTTCTCTTGAGGG + Intronic
1031572050 7:123371228-123371250 AATTATGTATTATCATTTAAGGG + Intergenic
1031750435 7:125564423-125564445 AATTATGCATATTTACTTAATGG + Intergenic
1032521904 7:132551887-132551909 TAATTAGTATGTTCATTTAAAGG - Intronic
1032913796 7:136463799-136463821 AAATATATATATTTATTTAAAGG - Intergenic
1037159746 8:15754539-15754561 AAATGTGCATTTTCACTAAAGGG - Intronic
1038591741 8:28845068-28845090 ACTTACATATGTTCACTTAATGG + Intronic
1039717111 8:40121601-40121623 AAATGTGTTTTTCCACTTAATGG - Intergenic
1040098287 8:43471245-43471267 AAATCAGTATGTTAACTTGAGGG - Intergenic
1040636672 8:49283461-49283483 ATATATGTATGTGCACTCCATGG - Intergenic
1040696425 8:50005352-50005374 AGATGTATATGTTCAATTAAAGG - Intronic
1040751124 8:50709890-50709912 AAATATGTGTGTTCTGGTAAAGG - Intronic
1041858969 8:62489351-62489373 GAATATATATTTTCATTTAATGG - Intronic
1041981113 8:63860776-63860798 AAAACTGTATGTTAATTTAAGGG + Intergenic
1042974555 8:74452563-74452585 AAATATGTATATTCATTTCTTGG - Intronic
1043101733 8:76055953-76055975 GCAAATGTTTGTTCACTTAATGG - Intergenic
1043402232 8:79895115-79895137 AAATGTGTATGTACATATAATGG - Intergenic
1043909060 8:85839489-85839511 AAATAAGTACTTTCACTTGAAGG - Intergenic
1045787922 8:105944572-105944594 AGAAATGTATGTTGTCTTAATGG - Intergenic
1046039486 8:108884992-108885014 AATTATATAAGTTCACTGAAAGG + Intergenic
1046254551 8:111679377-111679399 AAATATATATATTTAATTAAAGG + Intergenic
1046370079 8:113293204-113293226 AAATATATATGTATACTTAAAGG - Intronic
1047474051 8:125208534-125208556 AAATATCTATTTCCACTAAAAGG - Intronic
1047870444 8:129076440-129076462 AAATATCTGTGCTCACTGAAGGG + Intergenic
1048433028 8:134388296-134388318 ATATAAACATGTTCACTTAAAGG + Intergenic
1048653228 8:136504617-136504639 AAATATGTATGAGCACATATTGG - Intergenic
1050250630 9:3740384-3740406 AAATATGTATTTTCCTTTTACGG + Intergenic
1051288580 9:15522134-15522156 TAATATGAATTTTAACTTAAGGG - Intergenic
1052754914 9:32531066-32531088 AAATATGTGTATGAACTTAAAGG - Intergenic
1053696758 9:40646251-40646273 ATACATGTATGTACACTTCATGG - Intergenic
1054308009 9:63445482-63445504 ATACATGTATGTACACTTCATGG - Intergenic
1054440364 9:65254941-65254963 ATACATGTATGTACACTTCATGG - Intergenic
1054490043 9:65766997-65767019 ATACATGTATGTACACTTCATGG + Intergenic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1055217321 9:73881583-73881605 GAAAATCTATGTTCACTTTAGGG + Intergenic
1055557938 9:77494342-77494364 ATAAATTTATTTTCACTTAATGG + Intronic
1055722267 9:79188619-79188641 AAACATGTATTATCACTTGATGG - Intergenic
1057327456 9:94078604-94078626 GTATATGTTGGTTCACTTAATGG + Intronic
1058037456 9:100268410-100268432 ACATCAGTATGTTCCCTTAACGG + Intronic
1059091813 9:111367648-111367670 AAATATATAAGTTCACACAAAGG + Intronic
1060316265 9:122514083-122514105 AAACATGTCTGTTTACATAATGG - Intergenic
1062300112 9:135861608-135861630 AAATATATAGCTGCACTTAAAGG - Intronic
1202779210 9_KI270717v1_random:19897-19919 ATACATGTATGTACACTTCATGG - Intergenic
1203586271 Un_KI270747v1:6299-6321 ATACATGTATGTACACTTCATGG - Intergenic
1203617198 Un_KI270749v1:76898-76920 ATACATGTATGTACACTTCATGG + Intergenic
1187451679 X:19402489-19402511 CAATATATATGTTCACCAAAAGG + Intronic
1188170171 X:26914690-26914712 AAATAGGAATATTCACTAAAGGG - Intergenic
1188272772 X:28161318-28161340 AACTGTGTATGTTCACACAAAGG - Intergenic
1188918595 X:35943784-35943806 AAATAAGTATGCTCACATTAAGG - Intronic
1189755175 X:44264052-44264074 AAATATGAATATTCAGTTTAAGG + Intronic
1191818591 X:65276204-65276226 ACAAATATTTGTTCACTTAATGG - Intergenic
1192103415 X:68289827-68289849 TATTAAGTATGTCCACTTAATGG + Intronic
1193657728 X:84218884-84218906 AATTATGTATGTATACTCAAGGG + Intergenic
1193892644 X:87069443-87069465 AAATATATTTGATCACTTATGGG - Intergenic
1194778827 X:97997981-97998003 AATTATGTGTGTGCACTGAAAGG + Intergenic
1194839934 X:98727518-98727540 TATTATGTATTTTCACTTTAAGG + Intergenic
1195315444 X:103672920-103672942 TCATATTTATGTTCATTTAAAGG + Intergenic
1195944649 X:110196156-110196178 ATATATGTGTGTTTATTTAACGG - Exonic
1197455018 X:126668857-126668879 AAAAATGTATTTACTCTTAAAGG + Intergenic
1198892159 X:141409979-141410001 AAATATGTCTGTTCAGGGAAAGG + Intergenic
1201194483 Y:11478203-11478225 ATACATGTATGTACACTTCATGG - Intergenic
1201237845 Y:11928836-11928858 AAAAATGTATGTTAATTTATGGG + Intergenic
1201576038 Y:15462165-15462187 AAATATGACTGTCCAATTAAAGG + Intergenic
1202345861 Y:23925895-23925917 AAATATCTATGTTCATTGATTGG + Intergenic
1202524910 Y:25744195-25744217 AAATATCTATGTTCATTGATTGG - Intergenic