ID: 1138000019

View in Genome Browser
Species Human (GRCh38)
Location 16:53268529-53268551
Sequence ATTTATATGCACAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138000019_1138000023 9 Left 1138000019 16:53268529-53268551 CCCTCCTCCTTGTGCATATAAAT 0: 1
1: 0
2: 2
3: 21
4: 221
Right 1138000023 16:53268561-53268583 ACTAAAGTAGATATCAAGAATGG 0: 1
1: 0
2: 2
3: 33
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138000019 Original CRISPR ATTTATATGCACAAGGAGGA GGG (reversed) Intronic
904134332 1:28299707-28299729 ATTTATATGTAGAACCAGGATGG + Intergenic
905369880 1:37477299-37477321 GTTTGTATCCAGAAGGAGGAGGG + Intronic
907127860 1:52067307-52067329 ATTTATATATGCAAGGTGGAAGG - Intronic
908100582 1:60786912-60786934 AATTATATGTACAAAGAGCAGGG - Intergenic
908279159 1:62512427-62512449 ATTTATAAGGAAAAGGAAGATGG + Intronic
909377624 1:74958026-74958048 ATTTAAAGGCACAAGGTAGAAGG - Intergenic
909723650 1:78808313-78808335 ATTTAAATGAAAAAGAAGGAAGG + Intergenic
911841712 1:102690215-102690237 ATTTTTAGGCAAAAAGAGGAAGG + Intergenic
912067021 1:105756945-105756967 AGTTATATGCAGAAGAAGGCAGG - Intergenic
912414412 1:109498339-109498361 ATTTATATTCTGCAGGAGGAAGG + Intronic
916273754 1:162971648-162971670 ATTTAAGTGCACAAGGTGGGTGG + Intergenic
917167043 1:172124186-172124208 ATTCATATTCACATTGAGGAGGG - Intronic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
919098484 1:193064593-193064615 ATTTATATAATCAAGTAGGAAGG + Intronic
919659925 1:200234305-200234327 ATTTATATGGCCAAGAAGGCAGG - Intergenic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
923914756 1:238489566-238489588 ATTTATTTGCACAGGGATAAAGG + Intergenic
1066646886 10:37619334-37619356 TTTTATGTGAACATGGAGGAAGG + Intergenic
1066810620 10:39329055-39329077 ATTTGGATGCACATGGAGGCTGG - Intergenic
1068145090 10:53059172-53059194 ATGTTTATGCAAAAGAAGGAAGG - Intergenic
1068581166 10:58741267-58741289 ATTGATTTGCAGAAGGAGAAGGG + Intronic
1069802392 10:71090177-71090199 ATTGATAAGCCCCAGGAGGATGG - Intergenic
1070215478 10:74375126-74375148 ATTTATATGCAGAAAGTGTAAGG - Intronic
1073444908 10:103574772-103574794 ATTTATAGTCACAGGGGGGATGG - Intronic
1073619762 10:105034836-105034858 AATTATATGAACAAGGGGGAGGG - Intronic
1073848341 10:107585627-107585649 ATTCATGCGCACTAGGAGGATGG - Intergenic
1074784616 10:116827901-116827923 ATCTATATGCAGCAGGAGAAGGG - Intergenic
1076490758 10:130859725-130859747 ATGAAAATGCACAAGGAGGCCGG + Intergenic
1077010213 11:376270-376292 ATGAAGATGGACAAGGAGGAGGG + Exonic
1078377992 11:10812276-10812298 ATTCATAAGCACAGAGAGGATGG - Intronic
1081618478 11:44604531-44604553 TATTATATGGACAAGAAGGAAGG + Intronic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1086835430 11:91615284-91615306 AGTTGTATGCAGTAGGAGGATGG - Intergenic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1087469857 11:98558985-98559007 ATTTATAATAACAAGCAGGAGGG - Intergenic
1087907663 11:103717874-103717896 ATATATATGGAAAAGGAAGATGG + Intergenic
1088568794 11:111201134-111201156 ATGTATCTTCACATGGAGGAAGG + Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090870473 11:130741549-130741571 CTTAATATGCTCAAGAAGGAGGG - Intergenic
1091905102 12:4179369-4179391 ATTTAGATGAAGAAGAAGGAGGG + Intergenic
1093279897 12:17180545-17180567 GATTATATGCACATGTAGGATGG - Intergenic
1093427475 12:19044660-19044682 GTTTGTATGCACAATGAGCAAGG + Intergenic
1097538023 12:60898524-60898546 ATATATATGAATAAGTAGGATGG + Intergenic
1098196813 12:68010868-68010890 ACTCCTATGCAAAAGGAGGATGG + Intergenic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1098645423 12:72894773-72894795 ATATAGATGGAAAAGGAGGAAGG + Intergenic
1098889326 12:75992805-75992827 AATTATATGCACATGATGGAAGG - Intergenic
1099288798 12:80749200-80749222 ATACATATGCACAATTAGGAAGG - Intergenic
1099317389 12:81101483-81101505 ATATAAATGCACAAGCAGTATGG - Intronic
1100057281 12:90527243-90527265 CTTTTTATTCACAAGGAGTATGG + Intergenic
1100504567 12:95206839-95206861 ATTTTTAGGCAAAAGGAGGAAGG + Intronic
1100811320 12:98341303-98341325 ATTTAAAGGGATAAGGAGGAAGG + Intergenic
1101739599 12:107490624-107490646 ATTTAAATGCACCAGGAGACAGG - Intronic
1105370903 13:19801107-19801129 CTTCATATGCACAAGGCAGAAGG - Intergenic
1108565203 13:51689963-51689985 AATTGTATGCAGAAGCAGGATGG + Intronic
1109740006 13:66541104-66541126 ATTTATAGTTAGAAGGAGGAAGG - Intronic
1109944716 13:69418990-69419012 ATGTCTATTAACAAGGAGGATGG - Intergenic
1110662227 13:78070027-78070049 ATCCATGTGCACAACGAGGAAGG - Intergenic
1112135270 13:96571272-96571294 ATTTGCATGCACATGCAGGATGG - Intronic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1115104158 14:29739703-29739725 ATTTATATGCCCAAGGAAGGAGG - Intronic
1115125166 14:29983555-29983577 ATTTATATGCTCAATGAAGCAGG - Intronic
1118298794 14:64595513-64595535 ATTATTCTGCACAAGGAGGAGGG - Intergenic
1118786728 14:69052205-69052227 ATTTATAAACACAAGGTGGTTGG - Exonic
1118959812 14:70518691-70518713 ATTTATATTCACAATCAGGCTGG - Intergenic
1121395725 14:93621542-93621564 AATTGTATGCCCAAGGATGAGGG + Intronic
1123927622 15:25133850-25133872 TTTTACATGGACAAGGAGGAGGG - Intergenic
1126149014 15:45505516-45505538 ATTTTTATTCAAAAGGAGCAAGG + Intronic
1127442011 15:59018886-59018908 AGTTATATGCACAAATAAGAGGG - Intronic
1127869902 15:63063107-63063129 CTTTATATCCTGAAGGAGGAGGG + Intronic
1128213534 15:65918250-65918272 ATTTATGTGCAAATGGAGAAGGG - Intronic
1128383091 15:67127547-67127569 ATTAATATGCACAAGGGTGAAGG - Intronic
1128541148 15:68534213-68534235 ATGTGTATGCACAAGGAGGTGGG - Intergenic
1128870715 15:71153295-71153317 ACCTGTATGCACAAGGAGGCTGG - Intronic
1129508370 15:76101970-76101992 ATCTGTATGCAGTAGGAGGAAGG - Intronic
1131055765 15:89373645-89373667 ATATATATGCACACGTAGAATGG - Intergenic
1132329385 15:101001136-101001158 CTTTACATGCACAAGGATGCTGG + Intronic
1133652441 16:7825401-7825423 ATTTATATATATATGGAGGAAGG - Intergenic
1134818866 16:17229315-17229337 GGTCACATGCACAAGGAGGATGG - Intronic
1135883369 16:26280931-26280953 TTTTATATGTACAAGGAAGTTGG + Intergenic
1136147469 16:28323727-28323749 ATTTACAAACACATGGAGGAAGG - Exonic
1138000019 16:53268529-53268551 ATTTATATGCACAAGGAGGAGGG - Intronic
1139119067 16:63993420-63993442 ATTTATACACACAACAAGGATGG + Intergenic
1139806395 16:69567557-69567579 ATTTAGATACACTAGTAGGAAGG - Intronic
1140816830 16:78628896-78628918 AGATAAATGCACAATGAGGAGGG - Intronic
1143005797 17:3832739-3832761 ATATATCTGCAGAAGAAGGATGG - Intronic
1145405978 17:22594576-22594598 ATTTATATTTAAAAGGAGGATGG + Intergenic
1145803534 17:27708415-27708437 ATTGATTTGCACAAGGGGGCAGG + Intergenic
1146756728 17:35439135-35439157 GTTTGTGTGCACAGGGAGGAAGG + Exonic
1147306766 17:39569533-39569555 AATTATCTGCACATGGAGGGCGG + Intergenic
1149310608 17:55389330-55389352 ATTTTGCTGCACAAGGAGGGAGG + Intergenic
1149390583 17:56186285-56186307 TTTTATATGCTCAAGAAGGCTGG - Intronic
1153434799 18:5057927-5057949 ATTTATATCCACAAGATGGCAGG - Intergenic
1155138943 18:23025317-23025339 ATTTAGCTGCACAACAAGGAGGG + Intronic
1156029615 18:32696978-32697000 ACTTACATCCACAAGGCGGAAGG + Intronic
1158683778 18:59594221-59594243 ATTCATTTGTAGAAGGAGGACGG - Intronic
1159334938 18:67049926-67049948 ATTTATATGCAGACTGAAGAGGG - Intergenic
1159634872 18:70792635-70792657 ATATATATGTACAGGGAGGCTGG - Intergenic
1160149524 18:76388494-76388516 TTTCAGATCCACAAGGAGGAAGG + Intronic
1160677468 19:399093-399115 TTTTATACGCAGCAGGAGGAAGG - Intergenic
1164323505 19:24171764-24171786 ATTTAACTAAACAAGGAGGAGGG + Intergenic
1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG + Intergenic
1166125966 19:40715557-40715579 ATTTATATGCACAAGGAAGGAGG - Intronic
1168648726 19:58079107-58079129 ATATATATACACAAGGATGCTGG - Intronic
926347250 2:11958742-11958764 ACTTATATGAAAAATGAGGAGGG + Intergenic
926455158 2:13058192-13058214 ATTGATAAACAAAAGGAGGAAGG - Intergenic
926644257 2:15271970-15271992 ATTAATATGCAGAAGGAAAAAGG - Intronic
926778314 2:16444113-16444135 ATTTAAAAGAGCAAGGAGGAAGG - Intergenic
928248082 2:29649457-29649479 ATTTCTATGCACATGAATGAGGG + Intronic
928321407 2:30285568-30285590 GTTTATATGCACAAGTAAAATGG - Intronic
930154418 2:48091645-48091667 TTTTATTTGCACAAGGAGCCTGG + Intergenic
930389337 2:50740759-50740781 AGTTAAAAGGACAAGGAGGAAGG + Intronic
930515264 2:52399755-52399777 AATTAGATCCAGAAGGAGGAAGG - Intergenic
935836212 2:107057118-107057140 GTTTCTATGCACAAGGAGGGAGG + Intergenic
936592751 2:113819685-113819707 ATTAATATTCAAAAGGAGAAGGG + Intergenic
940385055 2:153061084-153061106 ATTTATATGCATACAGATGAAGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942180523 2:173376346-173376368 ATTCATATGCAAAAGAATGAAGG - Intergenic
942749951 2:179276270-179276292 ATTTCTATGCACTAGGGAGAGGG + Intergenic
944162311 2:196677276-196677298 ATTAACCTGCCCAAGGAGGATGG - Exonic
944997445 2:205309988-205310010 ATATATATACACAATGTGGAAGG + Intronic
946546337 2:220748667-220748689 ATTTGTATGAAGAAGGAGGAAGG + Intergenic
946795146 2:223343078-223343100 ATTTAGATCCACAAGGAGAGAGG - Intergenic
946814039 2:223557690-223557712 ATATATATGCAAAAGTGGGATGG - Intergenic
947160162 2:227206710-227206732 ATTTGTATGCACGTGGAGGTTGG + Intronic
948930833 2:241130987-241131009 AGTTAAATGCACAAGAAAGAAGG + Intronic
1169634796 20:7677471-7677493 TTTTATTTACAAAAGGAGGAAGG - Intergenic
1169848842 20:10027737-10027759 ATCTATATGCACAAACAGTATGG + Intronic
1171002847 20:21432180-21432202 ATTCATTTGCAAAAGAAGGAAGG - Intergenic
1171476538 20:25413775-25413797 GTTTATATGTTCTAGGAGGATGG + Exonic
1173632027 20:44523720-44523742 ATTTTTATCCAGAAGGAAGAAGG + Intergenic
1174994421 20:55550145-55550167 TTTTATATGTACAAGGACGTGGG - Intergenic
1175107155 20:56623782-56623804 TTTTAAATGCACAAAGAGGCTGG - Intergenic
1177662769 21:24107931-24107953 ATTAAAATGCACATGGAAGATGG - Intergenic
1181646854 22:24235974-24235996 ATATAGATGCACAAGGACCATGG - Intronic
1181920547 22:26317231-26317253 ATTTTTATGGACAAGGACAAGGG - Intronic
1182252008 22:29008110-29008132 ATTTGTATGCTCAATGAGGAAGG + Intronic
1182673607 22:32018851-32018873 ATTAAGATGCCCAAGGAGGGTGG - Intergenic
1184978162 22:48077770-48077792 ATTTATATACACAGGGGGGCTGG + Intergenic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
950510587 3:13423719-13423741 ACTTGTATGCCCAAGGAGAAAGG - Intergenic
951156569 3:19361893-19361915 ATTTGTATACATAAGGAGAAAGG + Intronic
951463610 3:22977700-22977722 CTTTATCTGTACAATGAGGACGG + Intergenic
952594413 3:34998773-34998795 ATTTACATGCAGAAGATGGAAGG - Intergenic
952814239 3:37433053-37433075 AATTATATACAGAAGAAGGATGG + Intronic
954855607 3:53641405-53641427 GTTCATATCCTCAAGGAGGATGG - Intronic
954856614 3:53649166-53649188 ATTTAAATGCACAAGGGTGTTGG + Intronic
955819325 3:62879438-62879460 ATTTACATGGACAAGATGGAGGG + Intergenic
959721033 3:109489410-109489432 ATTTATATGCAAAAAGAAGTTGG + Intergenic
960659657 3:120043850-120043872 GTTTAGATGGAGAAGGAGGAGGG - Intronic
964166791 3:153716810-153716832 GTGTGTATGCACAAGGAGGCAGG - Intergenic
964731550 3:159872129-159872151 ATCTATATGCACAAAGAAAAAGG - Intronic
965379981 3:167976432-167976454 ATTTTTATGCATAAGGAGAAAGG + Intergenic
965565078 3:170107121-170107143 ATTTTTATGCAGAAGCAAGAGGG - Intronic
965906624 3:173715547-173715569 ATTTCTATGTATCAGGAGGAAGG + Intronic
966033871 3:175385895-175385917 TTCTATATGCCCAAGGAAGAGGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967522555 3:190451131-190451153 ATTTGTATGCAAAAATAGGAAGG + Intergenic
969425987 4:7124167-7124189 ATTCATTTACACAAGGAGGTAGG - Intergenic
971330620 4:25678230-25678252 ATTGATATCTACAAGGGGGAGGG - Exonic
971446712 4:26758139-26758161 TTTTATAAGAACAAGGAGAAGGG - Intergenic
971997566 4:33984922-33984944 ATATATATTTAAAAGGAGGATGG - Intergenic
974401855 4:61418055-61418077 ATTTATAAGCACAAAAATGAAGG - Intronic
975059908 4:69984895-69984917 ATATATATTGACAAGGAGTAGGG - Intergenic
976981422 4:91236173-91236195 TTTTATATGTACAATGAGGCTGG - Intronic
979027153 4:115592159-115592181 CTTTGCATCCACAAGGAGGAGGG + Intergenic
979428032 4:120592188-120592210 ATATATATGAACAAGGATGGAGG - Intergenic
979566530 4:122160073-122160095 ATTTATGTGCACAAAGATGCTGG + Intronic
983168848 4:164512959-164512981 ATTACTATGCACAAGAAGGAGGG + Intergenic
983216508 4:165007431-165007453 ATTTATATGCACCAGCAGCAAGG - Intergenic
984379522 4:178972861-178972883 TTTTCTATCCATAAGGAGGAAGG - Intergenic
985163766 4:187070994-187071016 ATTTATATGTAAATGGAGGTTGG - Intergenic
986119403 5:4817673-4817695 ATTGATTTGCACAAGAATGAGGG + Intergenic
986942634 5:12973769-12973791 ATATATATGCACATGGGGAACGG - Intergenic
991400986 5:66251394-66251416 ATTTTAATGCCTAAGGAGGAGGG + Intergenic
992417231 5:76563282-76563304 ATTTAAATTTAGAAGGAGGAGGG + Intronic
994566604 5:101454553-101454575 AATTACGTGCACAAAGAGGAGGG - Intergenic
994866856 5:105284653-105284675 ATTAATATGCACAATGGGGCAGG - Intergenic
996218578 5:120899269-120899291 ATTTATATGCACAAGAAGGCAGG + Intergenic
996547151 5:124692114-124692136 ATTAATCTGCACAAGGAAGGAGG - Intronic
996593996 5:125180458-125180480 ATATATATGCTCCAGGAGGAAGG - Intergenic
996805074 5:127445597-127445619 ATTTATAGACACAAGCAGAAGGG + Exonic
997328529 5:133042340-133042362 AGTCACATGCACAAGAAGGAAGG - Intergenic
998921607 5:147074168-147074190 ATTCATATGCACAATAAGGTTGG + Intronic
1000200266 5:159002665-159002687 ATATATATAGAAAAGGAGGAAGG + Intronic
1000895869 5:166854695-166854717 ATTTATATTCAAGAGGGGGAAGG + Intergenic
1001186041 5:169573870-169573892 TTTTATAGGAACAAGAAGGAGGG - Intergenic
1001837144 5:174842060-174842082 ATCTATTGGCACTAGGAGGATGG + Intergenic
1001880131 5:175236159-175236181 ATTTCTATGCACAAGGTACAAGG + Intergenic
1007754240 6:44088544-44088566 ATTTAAATGAAGAAGGAGGCTGG - Intergenic
1008930967 6:56939446-56939468 TACAATATGCACAAGGAGGAAGG + Intronic
1010977093 6:82328093-82328115 ATTTACATCCTCAAGGAAGATGG - Intergenic
1011833015 6:91396106-91396128 ATTTATATGGGCAAGGAAGGGGG + Intergenic
1012301173 6:97590270-97590292 AACTATATGAATAAGGAGGAAGG - Intergenic
1013002743 6:106040761-106040783 AATTATATGCACATTTAGGAAGG - Intergenic
1013277519 6:108600020-108600042 TTTTATATGTATAAGGAGGGTGG + Intronic
1016079503 6:139838686-139838708 TTCTAAGTGCACAAGGAGGAAGG + Intergenic
1016355748 6:143216355-143216377 AGGTATATGGACAGGGAGGATGG + Intronic
1018592003 6:165436450-165436472 GGTTAAATGAACAAGGAGGAAGG + Intronic
1019861652 7:3664422-3664444 ATTTATAAGCACAATGAAAAAGG - Intronic
1020760007 7:12257325-12257347 ATTTATAGGCCCAAGTGGGAAGG + Intergenic
1023088212 7:36593605-36593627 GTTAATAGGCACAAGGAAGATGG - Intronic
1024353788 7:48394245-48394267 ATTTATATTCCAAAGGAGGAGGG - Intronic
1024945288 7:54801895-54801917 ATTTATATACAGGAGGTGGATGG - Intergenic
1027457504 7:78411835-78411857 ATTTAAATGAATAAGGAGAAAGG + Intronic
1027650270 7:80858163-80858185 AGTTATTTGTATAAGGAGGAAGG + Intronic
1027766768 7:82353808-82353830 ATTTCTATGCAAAAAGAGAAAGG + Intronic
1030115722 7:106060870-106060892 TTTTCCATGAACAAGGAGGATGG + Intergenic
1031346506 7:120673547-120673569 AATGATATGGAGAAGGAGGATGG - Intronic
1031622370 7:123950045-123950067 AATTATCTGCACAATGAGCAAGG + Intronic
1032225460 7:130027837-130027859 ATTTCTACTCACAAGGAGAAAGG + Intronic
1034481957 7:151328730-151328752 ATTCTTATGCAGAAGGAGAAAGG + Intergenic
1034485504 7:151358622-151358644 TTTTCCATGGACAAGGAGGAAGG - Intronic
1035961967 8:4147521-4147543 ATTAAAATGCCTAAGGAGGAGGG - Intronic
1038164113 8:25068081-25068103 ATTCTTAGGCACATGGAGGAAGG - Intergenic
1038954740 8:32455331-32455353 ATTTATAGGCATAAAAAGGATGG - Intronic
1039239108 8:35535226-35535248 ATTCATTTGTACATGGAGGAAGG + Intronic
1041742843 8:61175614-61175636 ATTTAAAGGCACAGGGAAGAAGG + Intronic
1041846552 8:62335785-62335807 GTTTTTATGGAAAAGGAGGATGG - Intronic
1045042503 8:98239428-98239450 ATTTACTTTCAGAAGGAGGAGGG + Intronic
1048127381 8:131651164-131651186 ATTCATATGAAAAATGAGGATGG + Intergenic
1049632520 8:143666337-143666359 ATGTGTGTGCACACGGAGGAGGG - Intergenic
1049632573 8:143666582-143666604 ATGTGTGTGCACACGGAGGAGGG - Intergenic
1049632649 8:143666925-143666947 ATGTACATGCACACGGAGGAGGG - Intergenic
1049632661 8:143666978-143667000 ATGTATGTGCACATGGAGGAAGG - Intergenic
1050334019 9:4573600-4573622 ATATATATGCACTAGGAACACGG + Intronic
1052671785 9:31567097-31567119 ATTTATATGAACAAGAACAAGGG + Intergenic
1053594427 9:39545538-39545560 ATTAATATGCACATGGAGATGGG + Intergenic
1054571830 9:66819429-66819451 ATTAATATGCACATGGAGATGGG - Intergenic
1055874408 9:80924734-80924756 ATTTGTTTGCATCAGGAGGATGG + Intergenic
1056043137 9:82688217-82688239 ATTTATAGGCTCACTGAGGAGGG - Intergenic
1056526101 9:87444361-87444383 TTTTTCATGCACATGGAGGAGGG - Intergenic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1059182892 9:112236071-112236093 ATTTATAGGCACAAGTATGTAGG + Intronic
1059780792 9:117524688-117524710 ATTTTTATGCAAAATGAGAATGG - Intergenic
1186389913 X:9148548-9148570 ATTTATTTGCTGCAGGAGGATGG - Intronic
1186667266 X:11730285-11730307 ATATTTAGTCACAAGGAGGAAGG - Intergenic
1186826823 X:13348819-13348841 ATTTATCTGCAAAATAAGGATGG - Intergenic
1187004190 X:15215766-15215788 AATTAAATGAACAAGGAGCAGGG - Intergenic
1187482398 X:19669595-19669617 ATTTATATGCAAAATAAAGATGG - Intronic
1189592327 X:42527597-42527619 ATTTATATACAGAAAGAGAATGG - Intergenic
1193668483 X:84353792-84353814 ATTTTCATGCAAAAAGAGGATGG - Intronic
1196646147 X:118119070-118119092 ACATATATGCACATAGAGGAAGG + Intergenic
1198635342 X:138692343-138692365 ATTTCAATGCACAAGGTTGATGG + Intronic
1200450501 Y:3321720-3321742 ATTTATATTCTAAAAGAGGAGGG - Intergenic