ID: 1138002757

View in Genome Browser
Species Human (GRCh38)
Location 16:53299034-53299056
Sequence CAGCCTCAGCACCTGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 11, 3: 42, 4: 364}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138002755_1138002757 8 Left 1138002755 16:53299003-53299025 CCTTATCATTTTCAGACAAGAAT 0: 1
1: 0
2: 2
3: 55
4: 325
Right 1138002757 16:53299034-53299056 CAGCCTCAGCACCTGGAACCAGG 0: 1
1: 0
2: 11
3: 42
4: 364
1138002754_1138002757 28 Left 1138002754 16:53298983-53299005 CCTTGATTATGTGATTACAACCT 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1138002757 16:53299034-53299056 CAGCCTCAGCACCTGGAACCAGG 0: 1
1: 0
2: 11
3: 42
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138002757 Original CRISPR CAGCCTCAGCACCTGGAACC AGG Intronic
900371364 1:2333597-2333619 CAGCAGCAGCACCTTGAGCCAGG - Intronic
900673966 1:3872543-3872565 CCTCTTCAGCACCTGGAACCTGG + Exonic
900923096 1:5686024-5686046 TAGCCTCAGAAACTGGGACCTGG - Intergenic
901231294 1:7642880-7642902 CAGCCTCAGCCCCTTGGACATGG - Intronic
901411120 1:9084805-9084827 CAGCCCCATCACCTGGGAGCTGG + Intronic
902756463 1:18552497-18552519 CAGTCTCTCCACCTGGACCCTGG + Intergenic
902838768 1:19062439-19062461 CACCCACAGCACCTGGCACAGGG - Intergenic
903540162 1:24092304-24092326 CGGCCTCGGCATCTGAAACCCGG + Exonic
903972424 1:27127685-27127707 CAGGCTCAGCACCTGGCATAGGG + Intronic
904369522 1:30039764-30039786 TAGCCCCAGCTCCTGGATCCTGG - Intergenic
904688715 1:32277889-32277911 GAGCCACAGCACCTGGAAGTAGG - Intronic
905308101 1:37032970-37032992 CAGCACCAGCGCCTGGCACCAGG - Intronic
906146396 1:43563255-43563277 CAGCCCCAGAGCCAGGAACCTGG - Intronic
906510333 1:46406932-46406954 CAGCCTCAGCTGCTGGCACCAGG + Intronic
906651727 1:47517566-47517588 CAGCCTCACCACCTACCACCAGG + Intergenic
906694875 1:47817220-47817242 CTGCCCCAGCTCCTGGATCCAGG + Intronic
907300216 1:53482272-53482294 CGGCCTCAGCAGCCAGAACCCGG + Intergenic
907336379 1:53702445-53702467 CAGCTTCCCTACCTGGAACCCGG - Intronic
911101829 1:94101536-94101558 CAGCACCAGCTCCTGGAAGCAGG - Intronic
912593521 1:110851256-110851278 CTGCCTCACCACCTGGATGCAGG - Intergenic
913233391 1:116760699-116760721 CAGCATGAGCACCTGTGACCTGG - Intronic
914732155 1:150381092-150381114 CATCCTCAGCACCTAGAAGAAGG + Intronic
915217271 1:154348711-154348733 GACCCACAGCACCTGGGACCAGG - Intronic
915450774 1:156003492-156003514 TAGCGTCAGCACCAGGAACAGGG + Intronic
915591665 1:156874432-156874454 CAGCCTCAGCTCCAGAGACCAGG - Intronic
915960729 1:160264275-160264297 CAGCCCCAGCACATAGAACAGGG - Intergenic
916078778 1:161218880-161218902 GGGCCTGAGCACCAGGAACCAGG + Exonic
916439246 1:164806764-164806786 CAGGCCCAGTGCCTGGAACCTGG + Intronic
916755933 1:167770377-167770399 CAAACTCAGCACCTGGAAGCAGG - Intronic
917211942 1:172640597-172640619 CTTCCTGAGCACCTGGCACCAGG - Intergenic
917457047 1:175193872-175193894 CTGGTTCAGCACCTGGCACCTGG - Intergenic
918782256 1:188715920-188715942 CAGCCTCAACAGCAGGGACCTGG + Intergenic
918963131 1:191306173-191306195 CAGCTTCTGCAGCTGGCACCAGG + Intergenic
919012921 1:191988429-191988451 CAACCTCAGCAGCTGCAACTCGG + Intergenic
919765896 1:201127214-201127236 CTGCCACAGCACCGGGAGCCAGG + Intergenic
922676804 1:227558551-227558573 CCGCCACAGCACCAGGAGCCTGG + Intergenic
922918277 1:229276892-229276914 CTTCCACAGCACCTGGAACCTGG + Intronic
923117660 1:230958528-230958550 GAGCTTCCACACCTGGAACCTGG + Intronic
923554625 1:234990967-234990989 AAGCTTCAACACCTGCAACCAGG + Intergenic
924159411 1:241215570-241215592 CAGCCAGAGCAGCTGGAAACTGG - Intronic
924420358 1:243903684-243903706 CAGAGTAAGCATCTGGAACCAGG - Intergenic
1063381253 10:5587663-5587685 TAGCCTGAGCCCCTGGGACCAGG + Intergenic
1064007180 10:11708001-11708023 CAGCTGCAGCACCTGGACCAGGG + Intergenic
1065154009 10:22851232-22851254 CTGCCTCAGCACCTAGCTCCAGG + Intergenic
1065353120 10:24813162-24813184 GAGCCACTGCACCCGGAACCCGG - Intergenic
1066621875 10:37363830-37363852 CAGCCTCAGCTCCTGTAGCTGGG - Intronic
1066627187 10:37418666-37418688 CAGCAGAAGCACCTGGACCCAGG + Intergenic
1068891051 10:62148685-62148707 CAGCCTCACCACCTTGACCATGG - Intergenic
1069824931 10:71249262-71249284 CAGCCTGGGCACCAGTAACCTGG + Intronic
1070328956 10:75404698-75404720 CAGCCTCAGCACCTGAAGCCTGG + Intergenic
1070594305 10:77821492-77821514 CAGGCCCAGGACCTGGAAGCAGG + Exonic
1070642902 10:78181920-78181942 TAGCCTCAGCATGTGGAGCCCGG + Intergenic
1070654709 10:78263391-78263413 CAGCCTTAGAACCTGTAAACTGG + Intergenic
1072082729 10:92047982-92048004 CACCCTCCTCACCTGGAAGCTGG - Intronic
1072816662 10:98516298-98516320 CAGCCTCAGCACCCAGCACAGGG + Intronic
1074255719 10:111800351-111800373 CAGCCTCAGGAAGGGGAACCTGG + Intergenic
1075588649 10:123675912-123675934 CATCCTCAGCTGCAGGAACCAGG + Intronic
1076186086 10:128450492-128450514 CAGCTTTAGCACCTGGAGCACGG + Intergenic
1076579394 10:131496531-131496553 CAGGCTCTGCACATGGACCCAGG + Intergenic
1076791767 10:132780617-132780639 GCGCCTCAGCACCTTGACCCTGG - Intronic
1076792467 10:132784680-132784702 CAGCCTCCGCACCGGGAACCCGG + Intergenic
1076873021 10:133202825-133202847 CAGCCTCTGCACCTGCATCTCGG + Intronic
1078850519 11:15158941-15158963 TAGCCTCAGCTCCTAGAACAGGG + Intronic
1079010941 11:16827664-16827686 CATCCTGATCACCTGGCACCAGG + Intronic
1080427973 11:32173522-32173544 TAGCCTCTGCATCTGGGACCAGG - Intergenic
1083894492 11:65613400-65613422 CAGCCGCAGCTCCTGGAAGCTGG + Exonic
1084210057 11:67616718-67616740 CAGCCTCCTCACCTGGGAGCAGG - Intergenic
1085442605 11:76578094-76578116 CAGCATCAGACCCTGGAAGCTGG - Intergenic
1085782685 11:79423712-79423734 AATCCTCAGCTCCTGGAAACAGG - Intronic
1086089963 11:82995760-82995782 CAGGCTAAGAACCTGGAACCCGG + Intronic
1087088647 11:94245481-94245503 CAGACTCAGCCCCAGGAGCCAGG + Intergenic
1088412776 11:109553762-109553784 CACCCTCATCACCTGGCAGCAGG + Intergenic
1088528118 11:110778526-110778548 CATTCTCAGCACTTAGAACCAGG - Intergenic
1088713350 11:112527571-112527593 GAGCCTCAGCTCCTGGCTCCAGG - Intergenic
1089388793 11:118086004-118086026 CAGCAGCATCACCTGGAAGCAGG + Intronic
1090062847 11:123478520-123478542 GAGCCTCAGGAACCGGAACCAGG - Intergenic
1090194254 11:124800809-124800831 CAGCCTCTGCACCTAGAGGCCGG - Intergenic
1092211769 12:6651035-6651057 CAGCCTCAGCACCGGGAGTGGGG + Exonic
1092494660 12:8980693-8980715 CAGCCACACCCTCTGGAACCAGG - Intronic
1096499670 12:52057052-52057074 CAGCACCAGCTCCTGGAACTAGG - Exonic
1096550218 12:52367228-52367250 CAGCCGCAGCCTCTGCAACCTGG - Exonic
1096684109 12:53276632-53276654 CAGCCTCAGTGGCTGGGACCCGG + Exonic
1096966597 12:55632819-55632841 CAGCCTCATCTCCTGCATCCAGG + Intergenic
1098156947 12:67609098-67609120 CATTCTCAGCACCAGAAACCAGG + Intergenic
1100326946 12:93549226-93549248 CATGCTCAGCACCTGGATCAGGG + Intergenic
1101645198 12:106624991-106625013 CAGTATCAGCACCAGGGACCTGG + Intronic
1101824214 12:108208123-108208145 CATCTCCAGCACCTGGAATCAGG - Intronic
1101852378 12:108414268-108414290 CACTCACAGCACCTGGAACACGG + Intergenic
1101997555 12:109535747-109535769 CTTCCTCAGCACAGGGAACCCGG + Exonic
1102150771 12:110688147-110688169 CAGGCTTAGCCCCTGGCACCAGG - Exonic
1102813631 12:115844631-115844653 CATTCTCAGCACCTGGAACAGGG + Intergenic
1103096484 12:118136515-118136537 CACCCCGAGCACCGGGAACCCGG + Intronic
1103253924 12:119523881-119523903 TAGCCCCAGCACCTGGCACCTGG - Intronic
1103380456 12:120490169-120490191 CATCTCCAGCACCTGGAACAGGG + Intronic
1103447758 12:121005360-121005382 CAGCTTCAGCACCTGGCACCTGG - Intronic
1103957020 12:124582930-124582952 CAGGCCCAGAACCTGGAGCCAGG + Intergenic
1104364360 12:128163693-128163715 GAGGCTAAGCACCTGGAATCAGG - Intergenic
1104808497 12:131605040-131605062 CAGCCACCCCACCGGGAACCGGG + Intergenic
1104892196 12:132145432-132145454 CAGCCTCCGCAGGTGGAAACAGG - Intronic
1104965534 12:132507356-132507378 CTGGCTCAGCTCCTGGCACCAGG - Intronic
1104973192 12:132540692-132540714 ACACATCAGCACCTGGAACCAGG + Intronic
1105603236 13:21905955-21905977 CAGCTCCAGCTCCTGGCACCTGG - Intergenic
1105947771 13:25204056-25204078 GAGCCTCATCACCTGGCACCTGG - Intergenic
1107940061 13:45375463-45375485 CATCCTCATCACCTGGCACCAGG - Intergenic
1109274628 13:60290254-60290276 CAGCGTCAGCAGCAGCAACCAGG - Intergenic
1111942339 13:94624015-94624037 CAGCATAAGCAGCTGGAGCCAGG + Intronic
1113117005 13:106884985-106885007 CACTCTCAGCACCTGGATCAGGG + Intergenic
1113171435 13:107508796-107508818 CAGTCTCATCACCTGAAAGCAGG + Intronic
1113657369 13:112075855-112075877 CATCCTCAGCACCTGGACACAGG - Intergenic
1114525698 14:23365928-23365950 CACCCTCGGCCCCTGGCACCCGG + Intergenic
1114664449 14:24369631-24369653 CAGCCCCCTCACCTGGCACCTGG + Exonic
1115307409 14:31946708-31946730 GAGCCCCAGCAGCTGGACCCTGG + Intronic
1119028553 14:71173845-71173867 CAGCACCAGCACCTGCCACCTGG + Intergenic
1119192766 14:72694457-72694479 GAACCTCAGCAGCTGGAACTGGG - Intronic
1120887551 14:89463656-89463678 CAGCCTCAGCCACTGGAGCCTGG + Intronic
1121055107 14:90845743-90845765 TAGCCTCAGCAACAGGAACTGGG + Intergenic
1121958819 14:98239986-98240008 TAGACTCAGCACATGGAACCAGG + Intergenic
1122058266 14:99119667-99119689 CAGCCTCGGCACCCAGCACCAGG + Intergenic
1122447527 14:101780899-101780921 CAGCCTCAGTCCCTGGACTCTGG - Intronic
1122649126 14:103216047-103216069 CGGCCTCAGCACCAGGCAGCAGG - Intergenic
1123774255 15:23562494-23562516 CAGCCTCAGAGGCTGGGACCTGG - Intergenic
1124200705 15:27676741-27676763 CAGGCACATCACCTGGAACTTGG - Intergenic
1124342794 15:28900962-28900984 CTGGCACAGCACCTGGAACTCGG + Intronic
1124583570 15:30984798-30984820 CAGCCTCAGCACAGGGGCCCAGG + Intronic
1124635234 15:31360907-31360929 CAGGCCCAGCACCTGCCACCTGG - Intronic
1126096689 15:45095329-45095351 CAGACTCAGTTCCTGGAGCCAGG + Intronic
1127638669 15:60894721-60894743 CAGCATCAGCTCCTGGGAACGGG - Intronic
1127640056 15:60907983-60908005 CAGCCTCACAGGCTGGAACCAGG - Intronic
1127703865 15:61528099-61528121 CAGTCTCAGGACCAGGACCCGGG + Intergenic
1127772638 15:62243684-62243706 CAGCCTCAGCCCCAGGGACTGGG - Intergenic
1128368954 15:67025188-67025210 CATTCTCAGGACCTGGCACCAGG - Intergenic
1128525236 15:68407870-68407892 AGCCCTCAGCACCTGGGACCAGG - Intronic
1128543417 15:68552143-68552165 CAGATTCAGGCCCTGGAACCAGG + Intergenic
1129414732 15:75368923-75368945 CAGCCTCAGAAGCAGCAACCGGG + Intergenic
1129682094 15:77663754-77663776 CAGCTTCAGCCCCTGGGACTTGG - Intronic
1129746497 15:78025336-78025358 CAGCGTCAGCATCAGGAAGCCGG - Exonic
1129772814 15:78213532-78213554 CTGCCTCATCACCCGGAACCTGG - Intronic
1129821109 15:78602605-78602627 CTGCTTCAGCACCTGGCTCCAGG - Intronic
1130120415 15:81042775-81042797 GAGCCACCGCACCTGGCACCAGG - Intronic
1130235766 15:82132214-82132236 CTGCCTCAGCACCAGGACACAGG - Intronic
1130883309 15:88073364-88073386 CAGCAGCATCACCTGGAAACTGG + Intronic
1130957967 15:88640328-88640350 CATCCCCAGCACCTGGAGCCTGG - Intronic
1130993628 15:88891857-88891879 CAGGCTCCACACCTGGAACCAGG + Intronic
1131226469 15:90628472-90628494 GATCCTCAGCACCTGGCACAGGG - Intronic
1131360303 15:91784693-91784715 CAGCTTCTGCACATGGAGCCAGG + Intergenic
1132926616 16:2433016-2433038 CGGCCACAGCTCCTGGAAGCTGG - Exonic
1133060271 16:3170473-3170495 CAGCCCCAGCGGATGGAACCCGG - Intergenic
1134597672 16:15509032-15509054 CAAGCTAAGCACCTGGAGCCTGG + Intronic
1134847132 16:17449427-17449449 CAGGCCCAGCACCTGGAAGAGGG + Intronic
1137678295 16:50315477-50315499 CAGCCCCAGCCCCTGAAACTTGG - Exonic
1138002757 16:53299034-53299056 CAGCCTCAGCACCTGGAACCAGG + Intronic
1138490716 16:57374690-57374712 CCGCCCCAGTACCTAGAACCAGG - Intronic
1139595971 16:67958505-67958527 CAGCCTTAGTCCCTTGAACCTGG + Intronic
1139912622 16:70407525-70407547 CAGCCTCAGCAACTTGGACATGG - Intronic
1139937197 16:70579929-70579951 CAGCCTCAGCCTCTCCAACCTGG + Exonic
1140041046 16:71408377-71408399 CAGCCTGATCAACTGGAACTTGG - Intergenic
1140472939 16:75225175-75225197 CATCCTCAGCACCTGCCCCCAGG + Intergenic
1140687847 16:77450829-77450851 CAGCCTGAGCTGCTGGACCCTGG + Intergenic
1141173616 16:81705539-81705561 CAGGTTCAGCACCTGGAGCATGG - Exonic
1141361232 16:83396919-83396941 CAGCTTCCTCAACTGGAACCTGG - Intronic
1141395205 16:83698472-83698494 GAGCCTCAGCACTGGGAACCAGG - Intronic
1141781136 16:86162203-86162225 CAGCCTCAGTGCCAGCAACCAGG - Intergenic
1142157151 16:88537765-88537787 CAGACTCAGAGCCTTGAACCTGG - Intergenic
1142589683 17:997254-997276 CAGCCCCGGCTCCTGGAGCCTGG + Exonic
1142868808 17:2807671-2807693 CAGCTTCAGCAGGTGGGACCTGG + Intronic
1143286630 17:5794847-5794869 GAGCCCCAGCCCCTGGAACCTGG - Intronic
1144389314 17:14778936-14778958 CAGTCCCAGCACCTGAACCCAGG + Intergenic
1144715868 17:17435572-17435594 CAGGCTCAGCTCCTGCAGCCAGG - Intergenic
1145311232 17:21702186-21702208 CAGCCACAGCCCCTGGCACCAGG - Intronic
1146012488 17:29207026-29207048 CTTCCTCAGTACCTGGCACCTGG + Intergenic
1146617350 17:34367555-34367577 CAGCATCAGCACATGAACCCAGG + Intergenic
1147316976 17:39625676-39625698 CAGCCCCAGCATCTGGGTCCTGG - Intergenic
1147608127 17:41785753-41785775 CAGCCACAGCTACTGGAAACTGG + Intronic
1147627730 17:41910673-41910695 CAGCCTCAGGACATGGGTCCGGG + Intronic
1147746624 17:42698843-42698865 CAGCCCCAGCCCCTGGCCCCCGG + Exonic
1148862787 17:50613305-50613327 CAGCCTCAGCACCTGCCGTCTGG + Intronic
1148863044 17:50614465-50614487 CTTCCTCAGCACCTGGAAGAGGG + Intronic
1149779584 17:59386725-59386747 AAGCCTCAAAACCTGGAACCTGG - Intronic
1149851578 17:60039408-60039430 CATCCTCAGCTCCAGGAACATGG - Intergenic
1149899456 17:60460459-60460481 GAGCCTCTGCACCTGAAAACTGG + Intronic
1150245593 17:63672415-63672437 CCTTCCCAGCACCTGGAACCAGG - Intronic
1151927840 17:77211844-77211866 CAGCTTCAGCACCTGCACCCTGG + Intronic
1151947075 17:77325595-77325617 CAGCCACACCACCTAGAACAAGG - Intronic
1152071671 17:78137231-78137253 CAGCTTCAGCACCACGCACCTGG - Exonic
1152520515 17:80853290-80853312 CAGCCTCTCCACCTGCAACGCGG + Intronic
1152642429 17:81454766-81454788 CAGCCTTGGCACCTGGAACAAGG - Intronic
1152721196 17:81924573-81924595 CAGCCTCACCTCCTGGTCCCAGG - Intronic
1152875917 17:82786133-82786155 AATCATCTGCACCTGGAACCAGG + Intronic
1153023968 18:657442-657464 CAGCCACCGCACCTGCATCCAGG + Intronic
1154191799 18:12236356-12236378 CAGTCACAGCAGCTGGCACCTGG + Intergenic
1154979302 18:21489286-21489308 TAGCCTCATCACCTGAGACCTGG - Intronic
1156482782 18:37446526-37446548 CAGCTTCACCACCTGGAAGATGG + Intronic
1156507242 18:37605647-37605669 CTGCCTCAGCACCTGTAGCTGGG + Intergenic
1160321584 18:77900640-77900662 CGCCGTCTGCACCTGGAACCCGG - Intergenic
1160569076 18:79804263-79804285 CAGCCACAGCCGCTGGACCCTGG + Intergenic
1160705512 19:528227-528249 CAGCCTGAGCAACAGGAACGGGG + Intergenic
1160818595 19:1047617-1047639 CGGCCTCGCCACCTGGTACCTGG + Exonic
1161216751 19:3098522-3098544 CAGCCTCAGGCCCTGGGAACAGG - Intronic
1161453720 19:4360194-4360216 CAGCCCCTGCACCTGGGAACTGG + Intergenic
1161548248 19:4895578-4895600 CCGCCTCTGCACCTGGACTCGGG + Intronic
1162329171 19:10016793-10016815 TAGCCTCAGCACCTAGAATAGGG + Intronic
1163700649 19:18785130-18785152 CAGCCCCAGCCCCCGGAACCTGG + Intronic
1164918615 19:32071916-32071938 CAGCAACAGCACCTGGGGCCAGG + Intergenic
1165309178 19:35020252-35020274 AAGCCACTGCACCTGGACCCTGG - Intronic
1167232002 19:48290737-48290759 CAGCCTCAGCGACTGGAGGCGGG - Intergenic
1167242136 19:48350579-48350601 AAGACACAGCACCTGGCACCGGG + Intronic
925060249 2:885381-885403 CAGCCCCAGGACATGGAGCCTGG + Intergenic
925386925 2:3468361-3468383 CAGCCTGAGCAGCTGGACCAGGG - Intronic
925594744 2:5544179-5544201 TAGCTTCAGGACATGGAACCCGG + Intergenic
926329219 2:11810988-11811010 CATTCTCAGCAACTGGAACAGGG - Intronic
926823796 2:16882216-16882238 CATCCTCAGCAGCTGGACCAGGG + Intergenic
927182662 2:20458068-20458090 CAGCCTCAGCATCTAGATCAGGG + Intergenic
927448657 2:23187694-23187716 GAGCAACAGCACCTGGAACCTGG + Intergenic
927537217 2:23872960-23872982 CAGTGAGAGCACCTGGAACCTGG - Intronic
928261318 2:29769526-29769548 GAGCCTCAGCACCTAGCCCCAGG + Intronic
929482655 2:42325287-42325309 AATCCTCAGCACTTGAAACCTGG - Intronic
930698025 2:54431246-54431268 GAGTCTCAGGACCTGGAACACGG - Intergenic
937095773 2:119234340-119234362 CAGCCTCAGCGTCTGGAGCTGGG - Intronic
937187627 2:120059835-120059857 CAGCCACTGCACCTCAAACCTGG + Intronic
937321842 2:120965664-120965686 CTGCCGCAGCACCTGCATCCCGG - Intronic
937939533 2:127274435-127274457 AAGCCTGAGCAGGTGGAACCTGG + Intronic
937986708 2:127641303-127641325 CAGCCTCAGCCCCAGGAGTCAGG + Intronic
938080498 2:128367495-128367517 CAATCTCAGAACCAGGAACCCGG - Intergenic
943972412 2:194428079-194428101 CTGCCCCAGCACCTGGAAGGTGG - Intergenic
944656979 2:201885334-201885356 CATCCCCAGCCCCTGAAACCTGG - Intronic
945175120 2:207036313-207036335 CAACCTCACCATCTGGGACCTGG - Intergenic
945199929 2:207271492-207271514 CAGCCTCAGCTCCAGAAATCAGG + Intergenic
947593625 2:231398015-231398037 CGGCTCCAGGACCTGGAACCAGG - Exonic
947707135 2:232285389-232285411 CAGCCTCTCCACCTGCAACTGGG + Intronic
947915337 2:233828801-233828823 CACCCTCAGCTCCCGGGACCTGG - Intronic
948415093 2:237797365-237797387 CACCCTCAGCCCCTGGCCCCTGG + Intronic
948445945 2:238032962-238032984 CAGCCTCATCCCCTAGAAACCGG - Intronic
948566973 2:238893616-238893638 CAGGCTCAGAACCTGGAACACGG + Intronic
1169204747 20:3733238-3733260 CAGCCTCAGACCCTGGCACCTGG - Intronic
1170458804 20:16557669-16557691 CAGCCTCAGCCCCTGGCACCTGG + Intronic
1170588418 20:17752942-17752964 TAGCCCCAGTACCTGGAATCGGG + Intergenic
1172106770 20:32521805-32521827 CAGTCTCAGCCCAGGGAACCTGG - Intronic
1172425426 20:34852355-34852377 CAGACTCAGAACCTGGAACAAGG - Intronic
1172786781 20:37473771-37473793 CACCCTCAGCACCTGGCGACTGG - Intergenic
1173550420 20:43929377-43929399 CAGCCTCTGTTCCAGGAACCAGG + Intronic
1173667345 20:44772399-44772421 AAGCCTCAGCACCAAGAACAGGG + Intronic
1174429974 20:50460666-50460688 CAGCCTCAGCACGTAGTACACGG - Intergenic
1175296140 20:57910057-57910079 CACAGTCAGCACCTGGCACCTGG + Intergenic
1175503386 20:59465772-59465794 CAGCCTCGGCCTCGGGAACCGGG - Intergenic
1175910400 20:62402623-62402645 CAGCCCCATCCCCTGGACCCTGG + Intronic
1175996069 20:62812881-62812903 CAGCCTCAGGACGGGGACCCAGG + Exonic
1176061941 20:63176282-63176304 CAGCCTCAGCAGGTGCAAGCCGG - Intergenic
1176089419 20:63312329-63312351 CAGGCCCAGCACCTGCAGCCAGG - Intronic
1176170070 20:63692749-63692771 CAGCCTCATCATCTGGTCCCTGG - Intronic
1176196093 20:63836834-63836856 CTGCTTCACCACCTGGCACCCGG + Intergenic
1176300474 21:5096702-5096724 CATCCTCAGCACCAGGACCACGG + Intergenic
1177534786 21:22410294-22410316 CAGCAACAGCAGCTGTAACCTGG + Intergenic
1178588675 21:33891125-33891147 CAGCATCATCTCCTGGAACCAGG + Exonic
1179307070 21:40164385-40164407 CAGCTGCAGCACCTGGATTCAGG - Intronic
1179717915 21:43299483-43299505 CAGCCTCAGAACCAGGCACAGGG + Intergenic
1179856569 21:44165279-44165301 CATCCTCAGCACCAGGACCACGG - Intergenic
1181086336 22:20441152-20441174 GAGCTTCAGCACCTGGGAGCGGG - Intronic
1181423331 22:22817146-22817168 CAGCCTCAGCGACTGCATCCTGG + Intronic
1181726347 22:24813742-24813764 CATCCTCACCACATCGAACCAGG - Intronic
1183502999 22:38192426-38192448 AAGCCACAGCACCTGGCTCCAGG - Intronic
1184106110 22:42368453-42368475 CAGCCTCAGCGGCTGGAATTCGG - Intergenic
1184234682 22:43176774-43176796 AAGCCTCACCACCTGGCATCAGG + Intronic
1184319899 22:43733280-43733302 CAGCGTCACCACCTGGAACTGGG + Intronic
1184487718 22:44791015-44791037 GAGCCACCGCACCTGGAACTTGG + Intronic
1184785659 22:46670479-46670501 GAGCCTCGGCACCTGGACCCAGG - Intronic
1185122466 22:48980479-48980501 CCACCTGAGCACCTGGGACCTGG + Intergenic
1185354346 22:50357906-50357928 GAGCCACCGCACCTGGCACCTGG + Intronic
951107994 3:18768288-18768310 CAGCTTAAGCACCTGTCACCTGG - Intergenic
952125032 3:30290605-30290627 CGGCCCCAGCACTTGGCACCAGG + Intergenic
952419401 3:33117820-33117842 CAGGCTCTGCAGCTGGAACATGG - Intronic
952810503 3:37398259-37398281 CAGCCTGAGCACCTAGAAGGAGG - Intronic
953034949 3:39203306-39203328 GATCCTCATCACATGGAACCTGG - Intergenic
953456720 3:43048236-43048258 CAGTCTTAGCATCTGGAATCAGG + Intronic
953904104 3:46859665-46859687 CAGCCTTAGACCCTGGAACCTGG - Intronic
954199104 3:49013710-49013732 CAGCCTGATGACCTGGAGCCTGG + Exonic
954446960 3:50552009-50552031 CAGACTCAGAGCCAGGAACCTGG - Intergenic
955594378 3:60573049-60573071 CAGGCTCAGGACCTGCACCCAGG + Intronic
955653732 3:61222007-61222029 CAGCCTCTGCTCCTGGCTCCTGG + Intronic
956743962 3:72296799-72296821 GTGCCTCAGCGACTGGAACCAGG - Intergenic
958166023 3:89878472-89878494 CACACTCAGCTCCTGAAACCAGG - Intergenic
961485378 3:127212215-127212237 AAGCCTCAGCACCTGGATCCCGG + Intergenic
961573803 3:127819160-127819182 CAGCCGCTGCACTGGGAACCTGG - Intronic
961638893 3:128352444-128352466 CAGCCTCACCAGCTGGATGCGGG - Intronic
961721702 3:128901359-128901381 CAGCCACAGCCCCTTGTACCAGG + Intronic
962023844 3:131527099-131527121 CAGCCTCACGCCCTGGATCCAGG + Intergenic
962052734 3:131835242-131835264 GAGCCTCCGCACCTGGCCCCTGG - Intronic
962847941 3:139287438-139287460 CAGCAGCAGCACCTGGAAACTGG - Intronic
963116137 3:141730799-141730821 CAGGCTCAGTACCTGGAAAGCGG - Intergenic
963254111 3:143127635-143127657 CATCCTCTGCATCTGGAAACAGG - Intergenic
966688693 3:182722918-182722940 CAGCCTGAGCCGCTGGAGCCGGG + Intergenic
967270478 3:187728564-187728586 CAGCCTCAGCACCTGGGGCAGGG + Intronic
967807370 3:193727800-193727822 CAGCATCATCACCTGCCACCAGG - Intergenic
968614567 4:1571521-1571543 CAGCACCAGCACCCGGCACCAGG - Intergenic
969135822 4:5027927-5027949 CAGCCTCTGGATCTGGAAGCAGG - Intergenic
969348305 4:6582831-6582853 CACCCTCAGCCCCTGCATCCTGG + Intronic
969568899 4:7996396-7996418 CAGCCTGGGCACTGGGAACCTGG - Intronic
969664610 4:8549880-8549902 CAGGCTCAGCCCCAGGAACAGGG - Intergenic
970023213 4:11592445-11592467 CATGCTGAGAACCTGGAACCAGG + Intergenic
970545682 4:17127833-17127855 CAGCAACAGCACCTGGGAGCTGG + Intergenic
970742767 4:19256997-19257019 TAGCCTCAGCACCTGGAACTTGG + Intergenic
971343953 4:25795643-25795665 CAGACCCAGGACCTGGACCCAGG + Intronic
971516308 4:27490941-27490963 CAGCAGCAGCATCAGGAACCAGG - Intergenic
976897404 4:90128247-90128269 CCGCCTCAGCACCCGCAGCCCGG - Intronic
977197529 4:94081530-94081552 CAGCCTCAGGACATGGTGCCTGG - Intergenic
979763018 4:124430139-124430161 CAGCCTTAGCACCTGGTTCAAGG + Intergenic
980071178 4:128244075-128244097 CTGCCACAGCACCTGGTACAGGG - Intergenic
981114050 4:140969109-140969131 CAGCCTGAGCAAATGTAACCTGG - Intronic
982088952 4:151864003-151864025 CAGCCCCAGCACCAGGAACTGGG - Intergenic
984653107 4:182290307-182290329 AGGCCTCTGCAGCTGGAACCAGG - Intronic
984758112 4:183342668-183342690 TGGCCTCTGCACCTGGCACCTGG + Intergenic
985613098 5:901394-901416 CAACCTCATCACCTGGAACCGGG + Exonic
985782406 5:1878163-1878185 CAGGCACAGCACTTTGAACCAGG - Exonic
986168158 5:5293527-5293549 CCGCCTCAGCTCCTGAAACCCGG - Intronic
987320533 5:16764971-16764993 GAGCCACCGCACCTGGCACCAGG + Intronic
987335112 5:16892051-16892073 AATCCTCAGCACCTAGAACAGGG + Intronic
990249975 5:53903634-53903656 CAGACTCACTCCCTGGAACCAGG + Intronic
990350352 5:54909533-54909555 CAGCCTCATCTCCTAGAAACTGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
993719821 5:91311295-91311317 CAGCCCCAGCATCTAGCACCTGG - Intergenic
995285111 5:110379131-110379153 CAGCCTGTACACCTGGAATCTGG - Intronic
997377241 5:133405952-133405974 AATCCTCAGCACCTGGAATCGGG - Intronic
999128076 5:149261365-149261387 CAGCCTCAACAGGGGGAACCAGG + Intergenic
999155322 5:149453670-149453692 CACCCTCAGCAGCTGGCACAGGG + Intergenic
999567278 5:152878592-152878614 GAGCCACAGCACCTGGCCCCAGG - Intergenic
999906620 5:156148282-156148304 CAAACACAGCACCTGGAAACTGG + Intronic
1000012727 5:157247708-157247730 CAGCCTAAGCAACAGAAACCTGG + Intronic
1000699532 5:164431186-164431208 CAGGCTCAGCATGTGGACCCTGG - Intergenic
1001083943 5:168686917-168686939 CAGCCCCAGCCCCTGCCACCTGG + Intronic
1001999978 5:176191993-176192015 CACCCTCAGGTCCTGGCACCCGG + Intergenic
1002350616 5:178580925-178580947 CAGCCTCCGCTCCTGGACTCAGG - Intronic
1002527010 5:179820612-179820634 CAGCCTCTGCACCTGGGATCAGG - Intronic
1003258482 6:4494675-4494697 CATCCGCAGCACCTAGAACATGG - Intergenic
1003409739 6:5851624-5851646 CAGCCTCACCGCCTGGATCCTGG + Intergenic
1005564323 6:27074718-27074740 CAGCCTAAGCAGCTTTAACCAGG - Intergenic
1005642195 6:27807124-27807146 CAGACCCACCACCTGGAGCCTGG + Intergenic
1005954517 6:30654612-30654634 CAGTCCCAGCAACTTGAACCTGG + Intronic
1006364975 6:33610004-33610026 CAGCCCCAGCACCTGCTGCCTGG + Intergenic
1006423983 6:33952307-33952329 GAGCCTCAGCACCTGGACCTGGG + Intergenic
1006426097 6:33963805-33963827 AACCCCCAGCACCTGGCACCGGG + Intergenic
1007589377 6:43012198-43012220 CTGCCTGCGCCCCTGGAACCTGG - Exonic
1007634262 6:43288304-43288326 CAGCCCCAGCCCCAGGAACTGGG - Intergenic
1011089697 6:83583222-83583244 TATCCTCAGCACCTGGTACATGG + Intronic
1014169834 6:118266704-118266726 CTGCCCCAGCACCTGGAGGCAGG + Intronic
1015663834 6:135604536-135604558 CAGCTTCCGCAGCTGGCACCAGG - Intergenic
1018208107 6:161454480-161454502 CAAGCTTAGAACCTGGAACCTGG - Intronic
1019186778 6:170225083-170225105 CTGCCTGAGCACCTGGGAGCTGG - Intergenic
1019433139 7:1008603-1008625 CAGCCTCAGCTCCGAGAAACAGG + Intronic
1019883062 7:3880420-3880442 TAGCCTCAGCAGCAGGAGCCCGG + Intronic
1020414483 7:7930381-7930403 CAGGCTCAGCACCAGGTACTGGG - Intronic
1023035613 7:36128933-36128955 CAGCCACAGCTTCTGGAACAAGG + Intergenic
1024377746 7:48658266-48658288 CAGCAACAGGACCTGGAGCCTGG + Intergenic
1024577775 7:50778745-50778767 CAGCATCACAGCCTGGAACCTGG - Intronic
1024989553 7:55222336-55222358 CAGGCTGAGCTCCTGCAACCTGG + Intronic
1027198585 7:76048205-76048227 CAGCTTCAGCACCTCGGCCCAGG + Exonic
1029422276 7:100477808-100477830 CAGCTTCACCACCCGGAAACGGG + Exonic
1030754700 7:113273247-113273269 CAGCCTCAGGACACGGTACCTGG - Intergenic
1031965690 7:128026753-128026775 CAGCCTCAGCTCCTGGGACCTGG - Intronic
1032658229 7:133954919-133954941 CAGCTTCCACACCTGGCACCAGG + Intronic
1032848171 7:135769555-135769577 AAGCCTCAGCCCTAGGAACCAGG - Intergenic
1034393528 7:150803217-150803239 CAGCCTCAGGAGTTGGATCCAGG + Intronic
1034752788 7:153586616-153586638 CAGCCTCATCACCTGGTGACAGG - Intergenic
1035056790 7:156041211-156041233 CTGCCTGTGCACCTGGAGCCAGG + Intergenic
1035448195 7:158957296-158957318 CAGCCCCAGCAGCCGGGACCTGG - Intergenic
1035561372 8:606524-606546 CAGCCACAGGACCAGAAACCAGG - Intergenic
1036414033 8:8530125-8530147 CAGTCTCAGCACAAGAAACCTGG - Intergenic
1036512841 8:9416778-9416800 CATCCTCAGTACCTGGGACAGGG - Intergenic
1036605875 8:10305330-10305352 CTGCTTCAGCACCTTGAAGCAGG - Intronic
1036649626 8:10634042-10634064 CAGCCTCAGCTCCTACAACAAGG + Intronic
1036717460 8:11139546-11139568 GAGCCTCACCTCCTGGAACTCGG + Intronic
1037475616 8:19254029-19254051 CTGCCTCAGGACCTGGCAGCTGG - Intergenic
1037764850 8:21766415-21766437 TATCCTCAGCACCTCGAACAAGG + Intronic
1038098136 8:24339455-24339477 CAACCTCAGTTCCTGGGACCAGG - Exonic
1039699694 8:39949580-39949602 GAGCCTCAGCACCTGGAACATGG + Intronic
1040387431 8:46922947-46922969 CAGCCCCAGCACCTGCACCTAGG + Intergenic
1041110335 8:54477231-54477253 CAGCCTGAGCAGCTGGAGCAGGG + Intergenic
1041210754 8:55548770-55548792 GAGCCACTGCACCTGGCACCTGG + Intergenic
1044335854 8:90984775-90984797 CTGCCCCAGCACCTGGTGCCAGG - Intronic
1044534060 8:93339485-93339507 CAGCTTCATCACCTGCAAACTGG + Intergenic
1045903222 8:107310529-107310551 CAGCCTCATCTCATGGAAGCAGG + Intronic
1046664882 8:116990068-116990090 CAGCCTCAGGAATTGGAAACTGG - Intronic
1047183229 8:122609000-122609022 CTGCCACAGCATCTGGAACACGG + Intergenic
1047887680 8:129270574-129270596 CAGCCTCTGCATCTGGAGGCAGG + Intergenic
1047985050 8:130224099-130224121 CAGGCTCAGCACTGGGAACTGGG - Intronic
1048032083 8:130642404-130642426 CAGACTCAGCATCTGGCACGTGG - Intergenic
1048990750 8:139758831-139758853 CAGCCTCACCACCTGGGACTTGG - Intronic
1049391129 8:142372268-142372290 CAGCCTCAGCTCCTGGGACCTGG + Intronic
1049826177 8:144670305-144670327 CAGGATCAGCACCTGGGACCAGG + Intergenic
1049867103 8:144946340-144946362 CAGCATCAGCCCCTGAGACCTGG - Intronic
1053142562 9:35690606-35690628 CAGCCCCTGCCCCTGGAGCCAGG + Exonic
1053298387 9:36931244-36931266 CAGCCTCAGTCGCTGGAGCCAGG - Intronic
1056350201 9:85741821-85741843 CCGGCTCAGCACCTGGATCACGG + Intronic
1056553461 9:87670582-87670604 CACCTGCAGCACCTGGCACCTGG + Intronic
1056706141 9:88954033-88954055 CAGCCACAACAGCTGCAACCTGG + Intergenic
1057083491 9:92189403-92189425 CAGCCCCGGCACCAGGCACCAGG + Intergenic
1057558456 9:96108243-96108265 CAGCCTCAGCAACAGGGAGCTGG + Exonic
1058450735 9:105093897-105093919 CAACCTCAGCTCCTGGCAGCTGG - Intergenic
1060026233 9:120174358-120174380 CAGACTCAGCACCGGGACCTTGG + Intergenic
1060395796 9:123315481-123315503 CAGGCCCAGCACCTGGAACCAGG - Intergenic
1060516659 9:124270226-124270248 CATCCTCAGCACCTGGAGCGGGG + Intronic
1061062578 9:128258040-128258062 CAGCCCCAGCCCCAGGGACCGGG - Exonic
1061358510 9:130124642-130124664 CAGGGTCAGCAGCTGTAACCTGG - Intronic
1061681690 9:132245627-132245649 CAGCCTCAGCACCATTGACCTGG + Intergenic
1061713761 9:132505709-132505731 CAGCCCCAGCCCCAGGAGCCAGG - Intronic
1062284930 9:135768634-135768656 CATCCTCAGCAGCAGGAACGAGG + Exonic
1062586474 9:137252052-137252074 CGGGCTCGGCACCTGGTACCTGG - Exonic
1186537002 X:10360295-10360317 CAGGCTGAGGACCTGGCACCTGG + Intergenic
1188451035 X:30308524-30308546 CAGGGGCAGCACCTGGAAGCAGG + Exonic
1189251019 X:39600766-39600788 CAGGCTGAGCCCCAGGAACCTGG + Intergenic
1189319330 X:40078165-40078187 CAGCCCCAGCACCTCCTACCAGG - Intronic
1192359873 X:70432703-70432725 CAGCCTCATCACCAGGGCCCTGG - Intronic
1196389881 X:115196113-115196135 CAGCCTCTGGCACTGGAACCAGG + Intronic
1196818989 X:119688037-119688059 TATCCTCAGCACCTGGCACGGGG + Intronic
1198242083 X:134796806-134796828 CAGCCGCAGCATCTGTAGCCCGG - Intronic
1199985482 X:152947044-152947066 CAGCCTCATCACCTTGCCCCTGG - Intronic
1200246743 X:154530556-154530578 CGGCCTCACCTCCTAGAACCCGG + Intergenic
1200884637 Y:8254908-8254930 CAGTCTCTGCACCTTGAAACAGG - Intergenic
1201420020 Y:13788176-13788198 CAGCCTCAGACCTTGGAACTAGG - Intergenic
1201900202 Y:19041006-19041028 AAGCCTCACCACCTCAAACCAGG + Intergenic