ID: 1138004556

View in Genome Browser
Species Human (GRCh38)
Location 16:53320011-53320033
Sequence ATAAATAAATAGAAGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1450
Summary {0: 1, 1: 0, 2: 15, 3: 210, 4: 1224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138004553_1138004556 20 Left 1138004553 16:53319968-53319990 CCTTAAATGTACTTATTTAAATA 0: 1
1: 0
2: 7
3: 88
4: 869
Right 1138004556 16:53320011-53320033 ATAAATAAATAGAAGGAGCTGGG 0: 1
1: 0
2: 15
3: 210
4: 1224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138004556 Original CRISPR ATAAATAAATAGAAGGAGCT GGG Intronic
900764167 1:4492876-4492898 ATAAAGACATAGGAGGAGTTAGG + Intergenic
900930895 1:5736804-5736826 AAAAATACATAGAAATAGCTGGG - Intergenic
901596243 1:10387445-10387467 AAAAAAAAAAAAAAGGAGCTGGG + Intergenic
901782232 1:11601774-11601796 ATAAATAAATAAAAAAGGCTGGG + Intergenic
901888006 1:12237664-12237686 ATAAATAAATAAAATTAGCTGGG + Intronic
901941372 1:12664770-12664792 ATAAAAAAATAGAAACAGTTTGG - Intronic
901943988 1:12686007-12686029 ATAAATAAATAAGTGGAGCCAGG - Intergenic
902291445 1:15438157-15438179 ATAAATAAATAGTATAAGGTAGG + Intergenic
902427054 1:16331753-16331775 ATAAATAAATAAATGCAGCCAGG + Intronic
902605603 1:17567525-17567547 AAAAATACAAAAAAGGAGCTGGG - Intronic
902829846 1:19005185-19005207 ATAAATAAATAAAATTAGCCAGG - Intergenic
902848654 1:19134272-19134294 AAAAATAAATAAAAATAGCTGGG + Intronic
902982322 1:20133774-20133796 AAAAAAAAAAAGAATGAGCTGGG - Intergenic
903145825 1:21371427-21371449 AAAAAAAAAAAGAAGGAGTTGGG + Intergenic
903793617 1:25911649-25911671 ATAAATAAATAAAATTAGCTGGG + Intergenic
903909376 1:26711265-26711287 ATAAATAAATAAAATTAGCCGGG - Intronic
903991687 1:27275633-27275655 ATAAAGAAAAAGATGGAGCGGGG + Intronic
904164987 1:28548542-28548564 ATAAATAATTAGCAAGAGGTGGG + Intergenic
904186575 1:28709736-28709758 ATAAATAAATAAAATTAGCTCGG - Intronic
904250110 1:29217368-29217390 ATAAATAAATAAAATTAGCCGGG - Intronic
904309588 1:29620037-29620059 ATAAATAAAATGAAGTGGCTGGG - Intergenic
904349976 1:29898878-29898900 ATAAATAAATAGGACAAGCAAGG + Intergenic
904504593 1:30940313-30940335 AAAAATAAAAAAAAGTAGCTGGG + Intronic
904549322 1:31302286-31302308 ATATAGAAGAAGAAGGAGCTAGG - Intronic
904683233 1:32243073-32243095 ATAAATAAATAAAATAAGCTGGG - Intergenic
904752694 1:32750799-32750821 ATAAATAAATAAAAGGGGCCGGG - Intronic
905167400 1:36091006-36091028 ACAAAAAAATAAAAGTAGCTGGG + Intronic
905454623 1:38079718-38079740 ATAAATAAATAAAAGGGGGCAGG - Intergenic
906497350 1:46314373-46314395 AAAAAAAAAGAGAAGGGGCTGGG + Intronic
906566870 1:46807146-46807168 TTAAATAAATCTAAAGAGCTAGG + Intronic
906818103 1:48899920-48899942 AGAAATAAATATTGGGAGCTAGG + Intronic
907212989 1:52839206-52839228 ATAAATAAATAAAATCGGCTGGG - Intergenic
907213152 1:52840265-52840287 ATAAGTAAATAAAAGTGGCTGGG - Intergenic
908235738 1:62145991-62146013 ATAAATATTTAGAAGGAACCAGG + Intronic
908267856 1:62396222-62396244 ATAAAAAAATAAAAGGGGCTGGG + Intergenic
908271620 1:62428095-62428117 ATAAATAAATAAAAAGAAATAGG + Intergenic
908463876 1:64372590-64372612 ATAAATAAGCAGAATGGGCTGGG + Intergenic
908612452 1:65877643-65877665 ATAAATAAATAAATAGTGCTGGG + Intronic
908955518 1:69621339-69621361 ATAAAGAAATACAAGAGGCTGGG - Intronic
909074125 1:71032725-71032747 ATAAATAAATATAAAAAGGTAGG - Intronic
909186463 1:72492563-72492585 ATAAATAAATAAAAGAAGGAAGG + Intergenic
909248102 1:73315104-73315126 ATAAATAAATAAAATTAGCTGGG + Intergenic
910328723 1:86043506-86043528 AAAAATAAAAAGAAGAAGTTTGG - Intronic
910498622 1:87862802-87862824 ATAAAAATATAGTAGAAGCTTGG - Intergenic
910582408 1:88843310-88843332 ATAAATAAATAAAAGAGGTTGGG - Intergenic
910585390 1:88873633-88873655 TCAAAAAGATAGAAGGAGCTTGG - Intronic
910991574 1:93061899-93061921 AAAAAAAAATAGAAGAAGCTGGG - Intergenic
910991699 1:93063366-93063388 ATATAGAAAAAGAGGGAGCTTGG - Intergenic
911031764 1:93496380-93496402 ATAAATAAATAAAATTAGCCAGG - Intronic
911195283 1:94988235-94988257 AGAAAGAAAGAGAAGAAGCTTGG + Intronic
911396998 1:97322250-97322272 ATAAATAAATAAAAGGAATTAGG + Intronic
911616550 1:100018496-100018518 ATAAATAAATAAAAGATTCTTGG - Intronic
911821406 1:102428227-102428249 ATAACTAAAATGAAGGAGCAAGG + Intergenic
912100964 1:106204044-106204066 ATAAATAAATAGAAGCAGAATGG + Intergenic
912308233 1:108593175-108593197 ATACATAAATAAAAGGAGTTTGG + Intronic
912340097 1:108906219-108906241 ATAAATAAATAAAAGTAGAAAGG - Intronic
912567029 1:110594957-110594979 AGAAAGCAATAGGAGGAGCTGGG - Intronic
912727797 1:112075045-112075067 ATAAATAAATAAAAGCAGCAGGG + Intergenic
912814542 1:112818508-112818530 ATAAAAAAATAAAATTAGCTGGG - Intergenic
912989047 1:114465744-114465766 AAAAATAAATAAAAAGAGCCGGG + Intronic
912989097 1:114466051-114466073 ATAAATAAATAAAAAGATCTTGG + Intronic
913466899 1:119152169-119152191 ATAAATAAATAAATGGTGCTGGG - Intergenic
913669622 1:121084252-121084274 AAAAATAAAAAGAATTAGCTGGG - Intergenic
914021380 1:143871651-143871673 AAAAATAAAAAGAATTAGCTGGG - Intergenic
914248020 1:145900250-145900272 ATAAATAAAAAGAAAGAGCAAGG - Intronic
914261501 1:146002977-146002999 AAAAATAAATAGATAAAGCTGGG - Intergenic
914294134 1:146303778-146303800 ATAAATAAATAGATCGGGCGTGG - Intergenic
914423892 1:147556417-147556439 ATAAATAAATAAATGAGGCTGGG - Intronic
914555178 1:148754561-148754583 ATAAATAAATAGATCGGGCGTGG - Intergenic
914659870 1:149779569-149779591 AAAAATAAAAAGAATTAGCTGGG - Intergenic
915098590 1:153482390-153482412 ATAAATAGATAAAAGGAACTTGG - Intergenic
915379293 1:155426047-155426069 ATAAATAAATAAAATTAGCCGGG - Intronic
915506236 1:156358123-156358145 ATAAATAAATAAAATGATCATGG + Intronic
915623103 1:157098255-157098277 ATAAAAATATAAAAGTAGCTGGG - Intronic
915701993 1:157805018-157805040 AAAAATAAATAAAATTAGCTGGG - Intronic
915971117 1:160355973-160355995 GTAAATAGAAAGAAGGAGCTAGG - Intronic
916452890 1:164938157-164938179 ATAAATAAAAAAAAGAAACTGGG - Intergenic
916461104 1:165025383-165025405 ATAAAAAAAGAGAAGTAGCAAGG + Intergenic
916799594 1:168204049-168204071 ATAAATAAATAAAAAGAACTTGG - Intergenic
916953948 1:169811877-169811899 ATAGATAGATAGATAGAGCTTGG + Intronic
917105955 1:171492394-171492416 AGAAAGAAAAAGAAGGAGTTGGG + Intronic
917282298 1:173389863-173389885 CTCAACAAATAGAAGAAGCTAGG - Intergenic
917350075 1:174067906-174067928 ACAAATATATAAAAGTAGCTTGG - Intergenic
917703450 1:177604768-177604790 ATAAAGAACTAGAATGAGTTGGG + Intergenic
917746863 1:178018440-178018462 ATAAATAAATAAAAAAGGCTGGG + Intergenic
917771515 1:178284837-178284859 ATAAATAACTAGAAAGATGTAGG + Intronic
917876132 1:179288849-179288871 ATAAATAAATAAAATTAGCCAGG + Intergenic
918055014 1:181013477-181013499 ATAAATAAAAAAAATTAGCTTGG - Intronic
918091908 1:181303750-181303772 ATTAAAAAATAGAAGGATGTTGG - Intergenic
918217182 1:182402095-182402117 ATAAATAAATAAATGGGGCCAGG - Intergenic
918223230 1:182455283-182455305 ATAAAGAAATAGGAGGAGGCGGG + Intronic
918274871 1:182944144-182944166 ATAAATAAATAAAAGAGGCCGGG + Intronic
918409146 1:184240597-184240619 ATAAATAAATAAAACTAGCCAGG + Intergenic
918534225 1:185556599-185556621 ATAAATTAAAAGAAGAAGCCTGG + Intergenic
918621834 1:186614229-186614251 ATAAATAAATAGAATTGGCAGGG + Intergenic
918939831 1:190978886-190978908 ATAAATAAAGACAAAGAGATAGG - Intergenic
919053212 1:192537184-192537206 ATAAATAAATAAATTGAGGTGGG - Intergenic
919334350 1:196213007-196213029 ATAAATAAATAAAATAACCTAGG + Intergenic
919965142 1:202515712-202515734 AAAAATAAAAAGAATTAGCTGGG - Intronic
920031906 1:203042621-203042643 ATAAATAAATAAAAGAAACAGGG - Intronic
920118017 1:203634957-203634979 ATAAATAAATAAATGGGGCCGGG - Intronic
920524378 1:206655915-206655937 ATAAATACATAAAATTAGCTGGG - Intronic
920618207 1:207516059-207516081 ATAAATATATAAAATTAGCTGGG + Intronic
920979722 1:210821995-210822017 ATAAATGAAGAGATAGAGCTGGG - Intronic
921023284 1:211256078-211256100 ATAAATAAATAAAATTAGCCAGG - Intergenic
921029462 1:211325115-211325137 AAAAAAAAAAAAAAGGAGCTGGG + Intergenic
921032364 1:211344912-211344934 ATAAATAAATAAAATTAGCAGGG - Intronic
921052434 1:211520450-211520472 ATAAATAAATAAAAGCGGTTGGG + Intergenic
921269683 1:213456269-213456291 ATATATTAATACAAGGACCTAGG - Intergenic
921639242 1:217532608-217532630 ATAAATAAGGAGAAGGTGGTAGG + Intronic
922357253 1:224788154-224788176 ATAGTTGAATAGAAGGAGCCTGG - Intergenic
922664344 1:227455880-227455902 ATCAAAAAATAAAAGGGGCTGGG - Intergenic
922946430 1:229519823-229519845 ATAAATAAATAAAATGAGTAAGG + Intronic
923185348 1:231567827-231567849 ATAAATCAATAGAAGGAAAGTGG + Intronic
923203566 1:231736107-231736129 ATAAATAAATGAATGGGGCTGGG - Intronic
923218539 1:231872362-231872384 TTAAATCAATAAAAGGAGTTAGG - Intronic
923825531 1:237495489-237495511 ACAAAAACATAGAAGGTGCTTGG - Intronic
924157064 1:241189133-241189155 ACAAATAAATAAAATTAGCTAGG - Intronic
924303882 1:242667011-242667033 ATAAATAAATACAATGGGGTGGG - Intergenic
924800612 1:247327364-247327386 ATAGACATTTAGAAGGAGCTAGG - Intronic
924816026 1:247442915-247442937 ATAAATAAATAGAAAAAGCCAGG - Intronic
1063489872 10:6454201-6454223 ATATATAAATAGACAGATCTTGG + Intronic
1063490663 10:6460785-6460807 ATAAATAAATGAAAGGGGCTGGG - Intronic
1063506962 10:6608308-6608330 ATAAATGAATAAAAGAAGGTAGG - Intergenic
1063568075 10:7189883-7189905 CAAAATAAATGGAAGGAGATGGG + Intronic
1063802314 10:9594261-9594283 ATAAATAAATAGAAGACTGTTGG + Intergenic
1063844582 10:10111927-10111949 ATAAATAAATAAAATTAGCCAGG + Intergenic
1063972512 10:11391045-11391067 AAAAATAACTAAAAGCAGCTGGG + Intergenic
1064262647 10:13798416-13798438 ATAAATAAATAGGACGGGCGTGG + Intronic
1064684908 10:17850524-17850546 ATAGATGAATAAAATGAGCTGGG + Intronic
1064702773 10:18038673-18038695 ATAAATAAATAAAAATAACTGGG + Intronic
1064769078 10:18705297-18705319 AAAAATAAATAAAAGTAGCTGGG - Intergenic
1065209121 10:23385999-23386021 AAAAATAAATCGAATTAGCTGGG + Intergenic
1065251974 10:23824285-23824307 ATAAATAAATAAAAAGAGGAGGG + Intronic
1065276657 10:24093152-24093174 ATAAATAAATAAAAATAACTGGG - Intronic
1065573438 10:27095674-27095696 ATAAATAAATAAGAGGAGGGAGG + Intronic
1065710622 10:28513698-28513720 ATAAATAATTATGAGGAGCTAGG + Intergenic
1065923726 10:30417156-30417178 ATAAATAAATAAAATTAGCTGGG - Intergenic
1066291697 10:34020318-34020340 ATAAATAGATAAAATTAGCTGGG - Intergenic
1066384872 10:34933554-34933576 AAAAAAAAAAAGAAGAAGCTGGG + Intergenic
1067117823 10:43448833-43448855 AAAAATAAAAAAAATGAGCTGGG + Intronic
1067137683 10:43625802-43625824 ATAAATAAATAAAAAGAGGCCGG + Intergenic
1067401960 10:45984100-45984122 ATAAAAATATTGAAGGATCTAGG - Intronic
1067484956 10:46639798-46639820 ATAACTACATAGAAGGGGGTGGG - Intergenic
1067870313 10:49953702-49953724 ATAAAAATATTGAAGGATCTAGG - Intronic
1067972279 10:50986248-50986270 ATAAATAAATATAAGTAACATGG - Intergenic
1068151930 10:53143434-53143456 ATATCTAAATCAAAGGAGCTAGG - Intergenic
1068437683 10:57013798-57013820 ATAAATAAATAAAATTAGCAGGG + Intergenic
1068616407 10:59122780-59122802 TTAAATAAATAGAAAGACCATGG - Intergenic
1068988654 10:63129669-63129691 AGAAAGAAATAGAAGGGGCTGGG - Intergenic
1069179198 10:65334655-65334677 TTAACTAAATACAAGGAGGTAGG + Intergenic
1069448205 10:68494108-68494130 ATTAAGAAATAGATGGAGTTGGG - Intronic
1070026385 10:72636160-72636182 ATAAATAAATAGGCCGGGCTTGG + Intergenic
1070036112 10:72726055-72726077 ATAAATAAATAAAAACAGATAGG - Intronic
1070090437 10:73279561-73279583 ATAAATAAATATAAGAAGTTGGG + Intronic
1070275143 10:74998760-74998782 ATAAATAAATGAAATTAGCTGGG + Intronic
1070610733 10:77930637-77930659 ATAAATAAATAGGCTGGGCTTGG - Intergenic
1070721386 10:78759635-78759657 CTCAATACAAAGAAGGAGCTTGG - Intergenic
1071187429 10:83060542-83060564 ATAAATCATGAGAAAGAGCTTGG - Intergenic
1071273949 10:84035529-84035551 ATAAATATCTTGAGGGAGCTAGG + Intergenic
1071345306 10:84686428-84686450 AAAAAAAAAAAGAAGAAGCTGGG + Intergenic
1071359288 10:84829536-84829558 AAAAGAAAAGAGAAGGAGCTGGG + Intergenic
1071444548 10:85733623-85733645 ATAAGAAAATAGAATCAGCTGGG - Intronic
1071534170 10:86414015-86414037 AAAAAAAAAAAAAAGGAGCTGGG + Intergenic
1071686740 10:87765880-87765902 ATAAATAAACAGAATTAGCCAGG + Intronic
1072053203 10:91726999-91727021 ATGAATTGATAGAAGGAGCCTGG + Intergenic
1072069057 10:91898972-91898994 ATAAAAAGAAAGAAGCAGCTGGG - Intergenic
1072561595 10:96580756-96580778 ATAAATACATACTATGAGCTAGG + Intronic
1072573988 10:96683170-96683192 ATAAATAAATAAAACAAGGTTGG + Intronic
1073113230 10:101075163-101075185 ATAAATAAATAGCTGGGGCTTGG - Intergenic
1073201372 10:101738451-101738473 ATAAATAAATAAAACTAGCCTGG + Intergenic
1073226263 10:101922549-101922571 CTTAAGAAATAGAAGGGGCTGGG - Intronic
1073276720 10:102318185-102318207 ATAAATAAATAGACTGGGCATGG - Intronic
1073372899 10:103006785-103006807 ATAAATAAATAAAATTATCTGGG - Intronic
1073876224 10:107924928-107924950 AAAAATAAATAGAATGAATTAGG + Intergenic
1074000007 10:109362320-109362342 AAAAATAAATAAAATGTGCTAGG + Intergenic
1075094172 10:119460367-119460389 ATAAATAAATAGAATGAGCAGGG + Intergenic
1075101080 10:119506690-119506712 ATAAATAAATAAAAGTATTTGGG - Intronic
1075104487 10:119529291-119529313 AAAAATAAAAAAAAGTAGCTGGG + Intronic
1075142158 10:119848450-119848472 AAAAATATAAAGAACGAGCTGGG + Intronic
1075195596 10:120355724-120355746 AGAAATAAATAAAAGGGGATTGG + Intergenic
1075565885 10:123503893-123503915 AAAAATAAAAAAAATGAGCTGGG - Intergenic
1075600883 10:123768407-123768429 ATAAATAAATAAATAAAGCTCGG + Intronic
1075656366 10:124163892-124163914 ATAATTAAAGAGATAGAGCTTGG - Intergenic
1075761700 10:124862542-124862564 ATAAATAAATAAAATCAGCTGGG - Intergenic
1076384900 10:130048861-130048883 ATAAATAAATAAAACTAACTGGG - Intergenic
1076528966 10:131131938-131131960 AGAAATACATAAAAGCAGCTAGG + Intronic
1077828559 11:5837606-5837628 ATAAATAAATAAAAGGGGAATGG - Intronic
1077957342 11:7035158-7035180 ATAAATAAATAAAATTAGCCAGG + Intronic
1078015257 11:7607959-7607981 ATAAAGAAAGAGAGGGAGGTAGG + Intronic
1078108206 11:8371862-8371884 AAAAATAAAGAGAAGGAGGGAGG - Intergenic
1078151133 11:8760460-8760482 ATAAAAAATTAGCAGGAGGTTGG + Intronic
1078193133 11:9109946-9109968 ATAAATAAATAAATGAAGCTAGG + Intronic
1078256908 11:9665879-9665901 TTTAATAAATAGATGTAGCTGGG + Intronic
1078356976 11:10639720-10639742 AAAAATAACTGGATGGAGCTGGG - Intronic
1079172379 11:18108665-18108687 ATAAATAAAAGAAATGAGCTGGG - Intergenic
1079499438 11:21086070-21086092 ATAAATAAATTGAATGAACCAGG + Intronic
1079645625 11:22860966-22860988 ATAAATAAATAAATAGATCTGGG - Intergenic
1079763819 11:24364383-24364405 ATATATAAATAAAAATAGCTGGG + Intergenic
1079959596 11:26906635-26906657 ATTAATAAAAAGAAGGGGCTTGG - Intergenic
1080182715 11:29443824-29443846 ATAAAGAAATACTAGGGGCTGGG + Intergenic
1080231418 11:30020610-30020632 ATAAATAAATAAAAATAACTGGG - Intergenic
1080529591 11:33161852-33161874 AAAAGTAAAAAGCAGGAGCTGGG - Intronic
1081057960 11:38434362-38434384 ATAAATAAATATAGGTTGCTTGG - Intergenic
1081310910 11:41570830-41570852 ATAAATAAATAGAAGTTGAGGGG - Intergenic
1081826600 11:46059885-46059907 ATAAATAAATAAAATCAGCTGGG - Intronic
1081838154 11:46174959-46174981 AAAAATAAAAAAAATGAGCTTGG - Intergenic
1081965948 11:47169829-47169851 ATAAATAAATAGGGTGAGTTGGG + Intronic
1081979260 11:47256329-47256351 AAAAATAAATAGAACGGGCACGG - Intronic
1082207031 11:49449681-49449703 ATGAAAAAATAGAAGGACGTTGG + Intergenic
1082759044 11:57108511-57108533 ATAAATAAAAAGCAGGAAATAGG - Intergenic
1082948180 11:58782404-58782426 AGAAAGAAATAGAAGGAGGATGG + Intergenic
1083352541 11:62041200-62041222 ATAAATAAATAAAATTAGCTGGG + Intergenic
1083652969 11:64214326-64214348 ATAAATAAATACAGTTAGCTGGG - Intronic
1083732932 11:64662796-64662818 ATAAATAAATAAAAGGGGTCAGG + Intronic
1083873718 11:65508548-65508570 AAAAAAAAAGAGTAGGAGCTGGG + Intergenic
1083908413 11:65689727-65689749 ATAAATAAATAAAAAGAGGAAGG + Intergenic
1084048419 11:66584570-66584592 ATAAATAAATAGTAGAAATTGGG + Intergenic
1084114996 11:67037576-67037598 ATAAATAAATAAAATTAGCTAGG + Intronic
1084755186 11:71234050-71234072 ATAAATAAATAAATAGAGCCGGG + Intronic
1085113697 11:73911341-73911363 AAAAATAAAAAAAAGTAGCTAGG - Intronic
1085243928 11:75082462-75082484 ATAAATAAATAAATAGTGCTAGG + Intergenic
1085434725 11:76490152-76490174 ATAAATAAATAAAAGAAGACTGG - Intronic
1085540436 11:77262864-77262886 AAAAAAAAAAAAAAGGAGCTGGG + Intronic
1085557144 11:77434606-77434628 GTAAATAAATAAAATTAGCTGGG - Intronic
1085596121 11:77811881-77811903 ATAAATAAATAGGCTGAGCTTGG + Intronic
1085617800 11:78014813-78014835 ATAAATAAATAAAACCAACTTGG - Intergenic
1085749047 11:79143707-79143729 ATAAATAAATAAATGGTGCTGGG + Intronic
1085815835 11:79736101-79736123 AAATAAAAATACAAGGAGCTAGG - Intergenic
1085960624 11:81457480-81457502 CAAAATAAATAGAAAGAGATAGG + Intergenic
1086345097 11:85887961-85887983 AAAAATAAATAAAATTAGCTAGG - Intronic
1086377644 11:86217339-86217361 ATAAATAAATAGAATAAAATAGG + Intergenic
1086411472 11:86548833-86548855 GTACATTAGTAGAAGGAGCTGGG - Intronic
1086573944 11:88316491-88316513 ATAAATAAATAAATGAAGCAGGG + Intronic
1086648239 11:89252059-89252081 ATGAAAAAATAGAAGGACATTGG - Intronic
1087336119 11:96847120-96847142 ATAAATAAATAGAATTACCTTGG + Intergenic
1087449978 11:98308519-98308541 ATAAATAAATAAAAGGCCTTTGG + Intergenic
1087714858 11:101596172-101596194 ATAAATAAATAAAAATAACTAGG - Intronic
1088002299 11:104896880-104896902 ATAAATAAATAAAATTAGCCAGG + Intergenic
1088066364 11:105725570-105725592 ATTAATTAAAAGAAGGAGATTGG + Intronic
1088952558 11:114586398-114586420 TGAAATAAAAAGAAGGAGTTGGG - Intronic
1088973929 11:114798042-114798064 CTAAAGAAATAGAAGGATCTGGG - Intergenic
1088974176 11:114800073-114800095 GGAAAGAAATAGAAGGATCTAGG - Intergenic
1089263093 11:117236254-117236276 ACAAAAAAATTGACGGAGCTAGG - Intronic
1089683655 11:120133484-120133506 ATAACAAAATAAAAGAAGCTTGG - Intronic
1090040810 11:123289661-123289683 AAAAATAAATAAAAAGAGCCTGG - Intergenic
1090300671 11:125635116-125635138 AAAAATAAATAAAATTAGCTGGG - Intronic
1090345941 11:126070790-126070812 ATAAATAAATAAAAGGAAAGAGG - Intergenic
1090594731 11:128309272-128309294 ATAAATCAAGAGCAGGAGCAAGG + Intergenic
1090720077 11:129463938-129463960 TTCAATAAATAGATGGTGCTGGG + Intergenic
1090746425 11:129709313-129709335 ATAAATAAATAAAATTAGCTGGG - Intergenic
1090798138 11:130153160-130153182 ATAAAGAAAAACAAGGAGATGGG + Intergenic
1090842131 11:130499442-130499464 ATAAATAAATAAAATTAGCTTGG - Intergenic
1091160755 11:133417454-133417476 ATAAATAAATAAAAGAATCCAGG - Intronic
1091467641 12:699197-699219 ATAAATAAATAAAATTAGCCAGG + Intergenic
1091932169 12:4404713-4404735 ATATATATATAAAATGAGCTGGG + Intergenic
1092233331 12:6790088-6790110 ATAAATAAATATAAGGTGGGAGG + Intronic
1092352128 12:7764177-7764199 ATAAATAAATAAAATGGGCTGGG + Intergenic
1092539480 12:9412016-9412038 ATAAATACAAAGAAGGAGAGGGG + Intergenic
1092698211 12:11198030-11198052 ATAACAAAAGAGAAGGAGATAGG + Intergenic
1092865080 12:12753367-12753389 ATAATTTAATAGAAGGGGGTTGG + Intronic
1092870097 12:12798513-12798535 ATAAATAAAAAGAAGAGGATTGG + Intronic
1093128509 12:15359561-15359583 ATAAATAAATAAAATTAGCTAGG - Intronic
1093145231 12:15557328-15557350 ATTAAAAAAAAGAAGAAGCTAGG - Intronic
1093275000 12:17115024-17115046 AAGAATTAAAAGAAGGAGCTTGG + Intergenic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094624671 12:32112299-32112321 TCAAATAAAAAGAAGGGGCTGGG - Intronic
1095375190 12:41518952-41518974 ATAAATAAATAAAAGGTGCTTGG + Intronic
1095593142 12:43928572-43928594 ATAAATAAATAAAACTAGCATGG - Intronic
1095657697 12:44689639-44689661 CTAAATAAAGAAAAGGAGCATGG - Intronic
1095667740 12:44821876-44821898 ATAAATAAATAAAACCAGCCGGG - Intronic
1096074470 12:48794064-48794086 ATAAATGAATAGATGAGGCTGGG + Intergenic
1096235117 12:49921163-49921185 TTAAATAAATACAATTAGCTAGG + Intergenic
1096721632 12:53527319-53527341 ACAAATAAATAAAATTAGCTGGG + Intronic
1096884219 12:54700298-54700320 ATAAATAAAGGCAAGGAGATGGG - Intergenic
1097211872 12:57377094-57377116 ATAAATAAATAAAAGAGACTTGG + Intronic
1097297433 12:57982115-57982137 ATAAATAAATAAAATTAGCCAGG + Intergenic
1097670262 12:62528338-62528360 ATATATAGATAGAAGTAGTTTGG + Intronic
1097678540 12:62627983-62628005 TTAAAAAAATAAAAGTAGCTAGG - Intergenic
1097879912 12:64677426-64677448 ACAAAAAAATAGAAATAGCTGGG - Intronic
1098017006 12:66115543-66115565 AGAAAGAAATAGAAGGGGCAGGG - Intergenic
1098187010 12:67907680-67907702 AGAACTAAATAGAAGGAGTGAGG - Intergenic
1098391387 12:69973190-69973212 AAAAATAAAAATAAGGAGATTGG - Intergenic
1098692581 12:73506958-73506980 GTAAATAAATGTAGGGAGCTGGG + Intergenic
1098710968 12:73761071-73761093 ATAAATAAATAAAAGTAGTTGGG - Intergenic
1099449776 12:82794929-82794951 AAAAATAAATAAAAGGAGGCCGG + Intronic
1099475851 12:83106560-83106582 ATAAATACATAGAAATATCTTGG + Intronic
1099650048 12:85415305-85415327 ATAAATAAATAAAATCAGCCAGG + Intergenic
1099970372 12:89494198-89494220 ATAAAAAAATAAAATTAGCTGGG - Intronic
1100072910 12:90743223-90743245 TTAAATAAATACAACTAGCTTGG + Intergenic
1100194453 12:92228504-92228526 ATAAATAAATAGAAATAGAGGGG - Intergenic
1100325160 12:93533440-93533462 AAAAATAAAAAAAAGTAGCTGGG + Intergenic
1100552998 12:95664346-95664368 ATAAATAAATAGACTGGGCATGG - Intronic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1100627105 12:96346465-96346487 ATAAATAAATAAAATTAGCCAGG + Intronic
1100961717 12:99969337-99969359 ATAAAAAAATAAAAATAGCTGGG - Intronic
1100990342 12:100244849-100244871 ATAAATAAATAAAATAAGCATGG - Intronic
1101014140 12:100481940-100481962 ATAAATAAATAAAATTAGCTGGG + Intronic
1101067658 12:101039518-101039540 ATAAATAAATAAAAAGAAGTAGG + Intronic
1101146503 12:101845777-101845799 ATAAATAAATTTAATTAGCTGGG - Intergenic
1101153439 12:101905748-101905770 ATAAATAAATAAAATCAGATGGG - Intronic
1101303954 12:103508620-103508642 ATAAATAAATAAATGGTGCTAGG - Intergenic
1101447112 12:104744836-104744858 ATAAATAAATAAATGATGCTGGG - Intronic
1101523378 12:105505441-105505463 AAAAATGAATAAAAGTAGCTGGG - Intergenic
1101689836 12:107066958-107066980 ATACATAAATAAAATTAGCTGGG - Intronic
1101899565 12:108781261-108781283 ATAAATAAATAAATTTAGCTGGG + Intergenic
1101926234 12:108973550-108973572 ATAAATAAATAAAATTAGCTAGG - Intronic
1101986940 12:109454566-109454588 AAAAATAAATAAAATGAGCCAGG + Intronic
1102095675 12:110238747-110238769 AAAAATAAATGCAAGGGGCTGGG - Intergenic
1102481360 12:113225997-113226019 ATAAATAAATAAAATTAGCTGGG - Intronic
1102641983 12:114374863-114374885 ATCAATAAAAAGAAGGAGGGAGG + Intronic
1102910718 12:116711773-116711795 AAAAATAAAAAAAAGGAGCCAGG - Exonic
1102944599 12:116974904-116974926 ATAAATAAAAAGATGAAGGTAGG + Intronic
1103075885 12:117982269-117982291 ATAAATAAACAAAAGGAAGTTGG - Intergenic
1103378745 12:120477612-120477634 ATAAATAAATAAAAAAAGCTGGG + Intronic
1103442601 12:120974447-120974469 ATAAATATATAAATGAAGCTGGG + Intergenic
1103475325 12:121213854-121213876 AAAAAGAAATAGAAAGGGCTGGG - Intronic
1103574333 12:121865826-121865848 CTAAAAAAATAAAAAGAGCTGGG + Intergenic
1106064973 13:26337590-26337612 TAAAACAAATAGAAGGAACTGGG + Exonic
1106233685 13:27843211-27843233 ATAAATAAATAAAATTAGCCGGG - Intergenic
1106513165 13:30429122-30429144 ATAAACAAATAAAAGTAGCCGGG + Intergenic
1106830327 13:33574579-33574601 ATAAATAAATAAAATTAGCCAGG + Intergenic
1107222720 13:38004845-38004867 ATATATATATAAAAGTAGCTGGG + Intergenic
1107884545 13:44864367-44864389 ATATATAAATACAATGTGCTGGG + Intergenic
1107921505 13:45213035-45213057 ATAAATAAATAAAATTAGCCGGG - Intronic
1107945806 13:45417005-45417027 ATAAATAAATAAGAGAAACTTGG - Intronic
1108057216 13:46496981-46497003 ATAAATAAATGAAACTAGCTGGG + Intergenic
1108552544 13:51560850-51560872 ACAAATAAATAAAAAGAGCTCGG - Intergenic
1108688040 13:52837644-52837666 AGAAATAAAGAGAAGCAGCCAGG - Intergenic
1108918787 13:55651797-55651819 AGAAATGAATAGAAGAAGGTTGG - Intergenic
1108970340 13:56367536-56367558 ATAAATAATTTAAAGGACCTTGG - Intergenic
1109192532 13:59342553-59342575 AAAAAAAAATAGAATGAGGTTGG + Intergenic
1109281078 13:60356420-60356442 ATAAATAAATAGAGAGAGGGAGG + Intergenic
1109435219 13:62290747-62290769 ATAAATAAATAAAACAAACTAGG + Intergenic
1109765841 13:66895986-66896008 ACAACTAATTAGCAGGAGCTGGG + Intronic
1109921162 13:69061678-69061700 ACAAAGAAATATAAGCAGCTTGG - Intergenic
1109996816 13:70138486-70138508 ATGAATAAATATAATGAGATAGG - Intergenic
1110012610 13:70356827-70356849 ATAAATAAATAAAATTAGCTGGG - Intergenic
1110138624 13:72100165-72100187 ATAAATAAATAGAGTGACTTGGG + Intergenic
1110519252 13:76456063-76456085 GAAAACAAATTGAAGGAGCTTGG + Intergenic
1110547901 13:76777040-76777062 ATAAATAAATAAAATTATCTAGG + Intergenic
1110602457 13:77390453-77390475 GTGAAGAAATAGAAGGAGATGGG + Intergenic
1110652451 13:77958335-77958357 ATAAATAAATAAAATAACCTGGG - Intergenic
1110788202 13:79558850-79558872 ATAAATAAATAATTGGTGCTGGG + Intergenic
1110796457 13:79644208-79644230 ATAAATATATAAAAATAGCTGGG - Intergenic
1111304570 13:86390481-86390503 ATAAATAAAAATAAGGAGAAAGG + Intergenic
1111896251 13:94145447-94145469 ATCAATATATTGAAGTAGCTAGG - Intronic
1112110157 13:96287764-96287786 AAGAATAAAAAGAAGGAGATGGG - Intronic
1112429111 13:99334105-99334127 ATAAATAAAAAGAATTAGCTGGG - Intronic
1112522659 13:100111170-100111192 AAAAAAAAAAAAAAGGAGCTGGG - Intronic
1113237462 13:108295333-108295355 ATAAATAAATAAAAATAGCTAGG - Intronic
1113282602 13:108805948-108805970 ATAAATAAATAAAATTAGCTGGG + Intronic
1113646197 13:111998224-111998246 ATAAAGAGGTAGAAGGAGCGTGG + Intergenic
1113988050 13:114335013-114335035 ATAGATTCATTGAAGGAGCTGGG + Intergenic
1114757029 14:25270840-25270862 ATAAATAAATATGAGAGGCTGGG + Intergenic
1114865942 14:26596876-26596898 ATAAATAAATAAATGGCACTTGG - Intronic
1115222863 14:31074355-31074377 ATAAATAAATAAAGTAAGCTGGG + Intronic
1115260938 14:31453096-31453118 AAAAATAAACAAAAGTAGCTGGG - Intronic
1115269046 14:31531423-31531445 ATAAATATATACAAGTGGCTGGG - Intronic
1115274797 14:31595591-31595613 ATAAATAAATGTATGCAGCTGGG - Intronic
1115319463 14:32063791-32063813 ATAAATAAATAAAATTATCTGGG - Intergenic
1115411509 14:33080460-33080482 ATAAATAAATAGTAGTAGACAGG + Intronic
1115443305 14:33461098-33461120 ATAAATAAATGGCAGGAGTCAGG - Intronic
1115553021 14:34521364-34521386 AAAAATTAATAGCAGTAGCTGGG - Intronic
1115662906 14:35514696-35514718 AAAAATAAATAAAATTAGCTAGG + Intergenic
1115817752 14:37181055-37181077 ATAAATAAATAAAATTAGCCGGG - Intergenic
1115828210 14:37301355-37301377 ATAAGTAAATAGATGGTGGTTGG - Intronic
1115977428 14:39012415-39012437 ATAAATAAATACCTGGGGCTGGG - Intergenic
1115980171 14:39042958-39042980 ATAAATAAATAAAAGAAACTTGG - Intronic
1116041316 14:39689554-39689576 TTAAATAAATAGAAAGAGAAAGG + Intergenic
1116170182 14:41390925-41390947 ATAAATAAAGAAAATAAGCTTGG + Intergenic
1116515509 14:45800353-45800375 AAAAATAAAAAGAATTAGCTGGG + Intergenic
1116798191 14:49414223-49414245 ATAAATAAATACAAAGTGCCAGG + Intergenic
1117693691 14:58337227-58337249 ATAAATAAAGAGAAGGTTCTAGG - Intronic
1117702872 14:58432709-58432731 ATAAATAAATAAAAGAAAATGGG - Intronic
1117720545 14:58624752-58624774 AAAAATAGGTAGAAGGGGCTGGG - Intergenic
1117775381 14:59178810-59178832 AAAAACAAATACAAGGAGATGGG + Intergenic
1117834593 14:59790077-59790099 ATAAATAATTAGAAATAGATAGG + Intronic
1117834641 14:59790931-59790953 ATAAATAATTAGAAATAGATAGG - Intronic
1117871067 14:60200627-60200649 AAAAATAAATAAATGGTGCTGGG + Intergenic
1118212618 14:63779614-63779636 ATAAATAAATAAAAGGAACCGGG + Intergenic
1118385256 14:65250862-65250884 ATAAATAAATGAAAGGGGCCAGG + Intergenic
1118615250 14:67570718-67570740 AAAAATAAAAAGGAGGAGGTAGG - Intronic
1118688119 14:68311905-68311927 ATAAATAAATAGAAGGTAACTGG + Intronic
1118810874 14:69272381-69272403 ATACATAAATAAAAAGTGCTAGG + Intronic
1119011256 14:70991497-70991519 AAAAATAAGTAGTAGGGGCTGGG - Intronic
1119096065 14:71832369-71832391 ATAAATAAATATTAAAAGCTAGG + Intergenic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119206306 14:72796513-72796535 ATAAATAAATAAATGGAGACAGG + Intronic
1119367980 14:74111595-74111617 ATAAATAAATACCAGGGGCAGGG - Intronic
1119925915 14:78493558-78493580 ATAAATAAAAAGAATTAGCCAGG + Intronic
1120006849 14:79367975-79367997 ATAAATAAATAAAAAGATCAGGG + Intronic
1120138631 14:80901212-80901234 AAAAATAAATAAAAGAGGCTTGG + Intronic
1120495906 14:85235013-85235035 ATAAATAATTAGAAAGTGATGGG - Intergenic
1120517996 14:85492718-85492740 ATACAAAAATAAAATGAGCTGGG + Intergenic
1120534948 14:85683314-85683336 GTAAATAAAAAGAGGGAGCCAGG + Intergenic
1120588806 14:86349850-86349872 ATAAATAATTCAAAGCAGCTGGG + Intergenic
1120792821 14:88600600-88600622 ATAAATAAATAAAATTAGCCAGG - Intronic
1121053718 14:90836510-90836532 CTAAGTAAATGGAAGTAGCTTGG - Intergenic
1121965923 14:98305715-98305737 ATTACTAAAAAGAAGGAGCTGGG + Intergenic
1122223146 14:100254750-100254772 ATAAATAAATAAAATAGGCTAGG - Intronic
1122223972 14:100261987-100262009 ATAAATAAAAATAATTAGCTGGG + Intronic
1122987441 14:105219017-105219039 ATAGCGAAAGAGAAGGAGCTCGG - Exonic
1202876452 14_KI270722v1_random:6743-6765 ATAAAAAAAAAGAAGGAGGTTGG - Intergenic
1123734760 15:23175055-23175077 ATAAATAAATAAAAGTAGCCAGG + Intergenic
1124285262 15:28396357-28396379 ATAAATAAATAAAAGTAGCCAGG + Intergenic
1124297434 15:28515269-28515291 ATAAATAAATAAAAGTAGCCAGG - Intergenic
1124463283 15:29912713-29912735 AAAAAAAAAAAGAGGGAGCTTGG + Intronic
1124797377 15:32795037-32795059 ATAAAAAAATAAAATTAGCTAGG + Intronic
1125324119 15:38518547-38518569 ATTAGTATATTGAAGGAGCTGGG + Intronic
1125522807 15:40357659-40357681 AAAAAGAAAGAGAAGGAGCTGGG + Intergenic
1125575032 15:40749354-40749376 AAAAATAAATAGAATTGGCTGGG + Intronic
1125680177 15:41525630-41525652 ATAAAAAAATAATAGGGGCTGGG - Intronic
1125786079 15:42319502-42319524 ATAAATAAAAAGAATTAGCTGGG - Intronic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1126162623 15:45628356-45628378 ATAAATAAATAAAAGTAGCCAGG - Intronic
1126312367 15:47332474-47332496 ATACATAACCAGAAGGAACTTGG + Intronic
1126785791 15:52177017-52177039 AAAAAAAAAAAGGAGGAGCTAGG - Intronic
1126810803 15:52401988-52402010 GAAACAAAATAGAAGGAGCTAGG - Intronic
1126823124 15:52524581-52524603 ATAAATAAATAAAATAGGCTGGG + Intronic
1127468574 15:59269391-59269413 TTAATTGATTAGAAGGAGCTGGG - Intronic
1127477282 15:59346754-59346776 ATAAACAAATAAAATTAGCTGGG + Intronic
1127887160 15:63211990-63212012 AAAATTAAATAAAATGAGCTGGG - Intronic
1127921693 15:63499569-63499591 ATAAATAAATAAAAGTTGTTTGG + Intergenic
1127941641 15:63703742-63703764 ATAAATAAATAAAATTAGCCAGG + Intronic
1128124085 15:65177954-65177976 ATAAAAAAATAAAATTAGCTAGG - Intronic
1128124394 15:65181455-65181477 ATAAAAAAATTGAAGGAGCCAGG + Intronic
1128151537 15:65366406-65366428 ATAAAGAAAGAGAAGGAGGGAGG + Intronic
1128451501 15:67808325-67808347 ATAAATAAAAATAGTGAGCTAGG + Intergenic
1128823053 15:70679430-70679452 ATAAATAAATAGAAGAGATTAGG + Intronic
1129018274 15:72489079-72489101 AAAAATAAATAAAATTAGCTGGG + Intronic
1129024423 15:72556406-72556428 CTCAATAAGTAGAAAGAGCTGGG + Intronic
1129195187 15:73960297-73960319 ATAAATAAATAAAATTAGCCAGG - Intergenic
1129277368 15:74455350-74455372 GTTTATAAATAGAAGGTGCTTGG - Intronic
1129377263 15:75141742-75141764 ATAAATAAATAAAATAAACTTGG + Intergenic
1129421127 15:75427672-75427694 ATAAATAAATAAAATAGGCTAGG + Intronic
1130097461 15:80866623-80866645 ATAAATAAATAAAATAAGCCAGG + Intronic
1130623435 15:85488056-85488078 AAAAATAAATACAAATAGCTGGG - Intronic
1130752451 15:86726720-86726742 ATAAATAAAAACAATTAGCTGGG - Intronic
1131263236 15:90900690-90900712 ATAAAAAAATAAAAAGAGCTGGG + Intergenic
1131396266 15:92088987-92089009 ATAAATAAATAAATAAAGCTGGG - Intronic
1131533537 15:93214888-93214910 ATAAATAAATAAAATTAGCCGGG - Intergenic
1131595142 15:93790802-93790824 ATAAATTTAAAGAAGGACCTGGG - Intergenic
1131672696 15:94636680-94636702 AAAAATAAAAAAAATGAGCTGGG + Intergenic
1131718300 15:95137942-95137964 AAAAATAAATAGAAGGCATTGGG - Intergenic
1131746964 15:95459183-95459205 ATAAATAAATAAAATGTGCAAGG + Intergenic
1132401815 15:101513988-101514010 ATAAATAAATAAGATTAGCTGGG + Intronic
1132839789 16:1973447-1973469 ATAAATAAGTAAAAAGAGGTAGG + Intronic
1133049519 16:3109223-3109245 ATAAATAAATAAATAGAGTTGGG + Intergenic
1133060052 16:3168881-3168903 ATAAATAAATAAAATTAGCTGGG - Intergenic
1133323268 16:4927943-4927965 ATAAATAAATAAAATTAGCTGGG + Intronic
1133549006 16:6835590-6835612 AAAAATAAAAAAAAGTAGCTGGG + Intronic
1133571835 16:7048552-7048574 ATAAAGAACCAAAAGGAGCTGGG - Intronic
1133596818 16:7301914-7301936 ATAAATAAATAAAGGCAGGTAGG + Intronic
1133795782 16:9045105-9045127 ATAAATAAATAAAAGGAAATTGG + Intergenic
1133826581 16:9283503-9283525 ATAAATAAATAAAACAAGCATGG - Intergenic
1133886402 16:9832077-9832099 ATAAATAAATAAAATAAGCCTGG - Intronic
1134115247 16:11543220-11543242 ATAAATAAATAAAATTAGTTGGG - Intergenic
1134178012 16:12024297-12024319 ATATATATATAAAATGAGCTGGG - Intronic
1134228153 16:12408180-12408202 AAAAAAAACTAGAAGCAGCTGGG + Intronic
1134316225 16:13121186-13121208 ATAAATAAATAAAATAATCTGGG + Intronic
1134392261 16:13830837-13830859 AAAAAAAAAAAGAAGGAGGTTGG - Intergenic
1134781172 16:16896766-16896788 AGAAACAGACAGAAGGAGCTCGG + Intergenic
1135068828 16:19334675-19334697 ATAAATTAATAAAATTAGCTGGG - Intergenic
1135086989 16:19483149-19483171 ATAAATAAATAGGCTGAGCATGG - Intronic
1135109144 16:19677224-19677246 ATAAATAAATAAAATTAGCCAGG - Intronic
1135140233 16:19915030-19915052 AGAAATAAAAAGAAGGAGGTTGG - Intergenic
1135237509 16:20771363-20771385 AAAAAAAAAAAAAAGGAGCTCGG - Intronic
1135388129 16:22063011-22063033 ATAAATAAAAAAAATTAGCTGGG - Intronic
1135608695 16:23845921-23845943 ATAAATAAAAAGAGAGAGCACGG + Intronic
1135693187 16:24562009-24562031 ATGAAGATATAGACGGAGCTGGG - Exonic
1135946670 16:26870924-26870946 ATAAATAAATACCTGAAGCTGGG - Intergenic
1135951121 16:26915221-26915243 ATAAATAAATAAAAAGGGCTGGG - Intergenic
1135952104 16:26924205-26924227 ATAAAGAAATAAAAGCTGCTAGG + Intergenic
1135990575 16:27216392-27216414 AACACTAAATAGATGGAGCTGGG + Intronic
1136036333 16:27543394-27543416 ATAAATAAATAAAAAGAGATCGG + Intronic
1136066635 16:27763309-27763331 ATAAATAAAAAAAAGTAGCCAGG + Intronic
1136628380 16:31475585-31475607 ATAAATAAATAAAATTAGCTGGG - Intronic
1136633147 16:31501284-31501306 ATAAATAAATAAAAGGATTTAGG + Intronic
1137010516 16:35315961-35315983 AGAGATAACTAGAAGGTGCTTGG + Intergenic
1137584160 16:49654107-49654129 GCAATTAAGTAGAAGGAGCTTGG + Intronic
1138004556 16:53320011-53320033 ATAAATAAATAGAAGGAGCTGGG + Intronic
1138293095 16:55864746-55864768 ATAAAAAAAAAGAATTAGCTGGG + Intronic
1138398280 16:56724829-56724851 ATAAAAAAATAGAAAGGGCCAGG - Intronic
1138437164 16:57009296-57009318 ATAAATAAATAAATAAAGCTGGG + Intronic
1138794598 16:59952616-59952638 ATAAATAAAAGAAAGGAACTGGG + Intergenic
1138879134 16:60989398-60989420 AGAACTAAATAGAAGAATCTAGG + Intergenic
1139100880 16:63765308-63765330 ATAAATAAATAGAAGTATTATGG - Intergenic
1139201228 16:64979459-64979481 ATAAATAAATAAAAGATGCTTGG + Intronic
1139462892 16:67136741-67136763 ACAAAAAAATAGAATTAGCTGGG - Intronic
1139598381 16:67971016-67971038 ATGAATAAATAAAATTAGCTGGG - Intergenic
1139608115 16:68034511-68034533 AAAAATAAATAAAATTAGCTGGG - Intronic
1139609171 16:68042668-68042690 ATAAATAAATAAAATTAGCCAGG - Intronic
1139684819 16:68595003-68595025 ATAAATAAATAAAATAGGCTGGG + Intergenic
1139897212 16:70297202-70297224 ATAAATAAATAGACTGGGCACGG - Intronic
1140060984 16:71569495-71569517 AGAAATAAAAAAAATGAGCTGGG - Intronic
1140111650 16:72009917-72009939 ATAAATAAATGGAGAGAGATGGG + Intronic
1140153672 16:72400027-72400049 ATAAATAAATAGATGGAAATAGG - Intergenic
1140167628 16:72570231-72570253 ATATAAAAATAGAAGGATCTCGG + Intergenic
1140487272 16:75303531-75303553 ATTAATAAACTGAATGAGCTGGG + Intronic
1140515937 16:75541780-75541802 TTAAATAAATAAAAGTAACTTGG + Intronic
1141113363 16:81288421-81288443 AAAAATAAAAAGAATGAGCTAGG - Intronic
1141401951 16:83756133-83756155 ACAAATTAATAGAAGGAAATAGG + Intronic
1141472555 16:84249130-84249152 ATAAATAGATATTAGGATCTGGG - Intergenic
1141586805 16:85039461-85039483 AAAAATAAATAAAAGTAGCTGGG - Intronic
1141848044 16:86624364-86624386 ATAAAGAAAAAGATGCAGCTAGG - Intergenic
1142102785 16:88284459-88284481 ATAAATACATAAAATTAGCTAGG + Intergenic
1142241198 16:88946907-88946929 AAAAATAAATACAATTAGCTGGG - Intronic
1142784075 17:2206416-2206438 ATAAATAAATAAAATTAGTTGGG + Intronic
1143173535 17:4943829-4943851 ATAAAAAAATAAAATTAGCTGGG + Intronic
1143207491 17:5154892-5154914 AGAAATAAATACAATTAGCTGGG - Intronic
1143274868 17:5703011-5703033 TTACATGGATAGAAGGAGCTGGG - Intergenic
1143526136 17:7473843-7473865 ATAAATAAGAAATAGGAGCTGGG - Intronic
1144276971 17:13679690-13679712 ATAAATAAATAGAAGACAGTTGG + Intergenic
1144446458 17:15334207-15334229 ATAAATAAATAAAAGTAGCCAGG - Intronic
1144473614 17:15565354-15565376 ATAAGAAAACAGAAGGAGGTTGG - Intergenic
1144618844 17:16802004-16802026 ATAAATAAATAGAATTTGATGGG + Intronic
1144893861 17:18513690-18513712 ATAAATAAATAGAATTTGATGGG - Intergenic
1144922907 17:18779457-18779479 ATAAGAAAACAGAAGGAGGTTGG + Intergenic
1145138366 17:20430583-20430605 ATAAATAAATAGAATTTGATGGG + Intergenic
1145215562 17:21049190-21049212 AAAAAAAAAAAGAAAGAGCTGGG + Intergenic
1145217707 17:21064691-21064713 ATAAATAAATAAAAGAGCCTAGG + Intergenic
1145839567 17:27983252-27983274 ATTAATACATAGAAAGAACTTGG - Intergenic
1145942804 17:28751914-28751936 ACAAAAAAATATAAGGAGCCGGG + Intergenic
1145977211 17:28991199-28991221 ATAAATAAATAAATGGAGGCTGG - Intronic
1146145603 17:30413564-30413586 TTAAATGAATAAAAGGAGGTTGG - Intronic
1146545100 17:33731545-33731567 ATAAGTAATTAGAAAGAGCTAGG + Intronic
1146697584 17:34921472-34921494 ATAAATAAATAAAATGTGGTAGG + Intergenic
1146739255 17:35267557-35267579 ATAAATAAATAAAATTAGCTGGG + Exonic
1146770824 17:35567548-35567570 ATAAATAAATAAAATCAGCCGGG + Intergenic
1146945897 17:36873295-36873317 AAAAATAAAAAGAATTAGCTGGG - Intergenic
1146995795 17:37319964-37319986 ATAAATAAATAAACTTAGCTGGG + Intronic
1147231003 17:39017844-39017866 ATAAATACAAAAAATGAGCTGGG - Intergenic
1147257412 17:39190124-39190146 ATAAATAAATAAAAGGGGCTGGG + Intronic
1147371517 17:39996125-39996147 AAAAAAAAAAAGAAGAAGCTGGG + Intronic
1147421731 17:40325287-40325309 ATAAATAAATAAAAAGAGGCTGG + Intronic
1147596309 17:41720182-41720204 ATAAATAAATAAATAAAGCTGGG - Intronic
1147851447 17:43446416-43446438 ATAAATAAATAAAATTAGCTGGG + Intergenic
1147901593 17:43789824-43789846 ATAAATTAACAGAAGGAGGCTGG - Intergenic
1147941182 17:44049436-44049458 AAAAATAAAAAAAAGTAGCTGGG - Intronic
1148030786 17:44619395-44619417 ATAAATAAATAAAATTAGCCAGG - Intergenic
1148426323 17:47600274-47600296 ATAAATAAATAAAATTAGCTTGG + Intronic
1148569999 17:48660601-48660623 ATAAATAAATAAAATGTACTAGG - Intergenic
1148656006 17:49284088-49284110 AGAAATAAATTGAAGAGGCTGGG - Intergenic
1148885669 17:50770779-50770801 ATAAATAAATAAAAGCAACAAGG - Intergenic
1149049157 17:52284250-52284272 ATAAATAAGTAAAATTAGCTGGG - Intergenic
1149309092 17:55376882-55376904 ATAAATAAATAAAAAGAGCCAGG + Intergenic
1149460020 17:56821068-56821090 ATAAATAAAAATAATTAGCTGGG - Intronic
1149872868 17:60198953-60198975 AGAAATAAATACAATTAGCTGGG + Intronic
1150100578 17:62420161-62420183 ATAAATAAATAAAATTAGCCGGG - Intergenic
1150189929 17:63227837-63227859 ATAAATAAATAAATGGTGCTGGG - Intronic
1150333729 17:64314903-64314925 ATAAATAAAAAAAATTAGCTGGG - Intergenic
1150729310 17:67678053-67678075 ATAAATAAATAAAATTAGCCAGG + Intronic
1150773064 17:68057987-68058009 ATAGATAGATAGATGGATCTTGG + Intergenic
1151112625 17:71696961-71696983 ATAAATAAATATATGGAGTGGGG + Intergenic
1151311619 17:73296255-73296277 ATAAAAAAATAAAATTAGCTGGG + Intronic
1151740277 17:75977295-75977317 ATAAATAAAAATAAGGACTTCGG - Intronic
1151789444 17:76295096-76295118 ATAAATAAATAAAATTAGCTGGG + Intronic
1152326158 17:79639144-79639166 AAAAATAAATAAAATTAGCTTGG - Intergenic
1152385709 17:79973275-79973297 ATAATAAAATAGAAGTGGCTGGG + Intronic
1152577179 17:81147593-81147615 ATAAATAAATAAAATTAGCCAGG + Intronic
1152620485 17:81361881-81361903 ATAAATAAATAAAAGAGGCCGGG - Intergenic
1152969770 18:150256-150278 ATAAAGAAATTGAAGGGGGTGGG - Intergenic
1153112168 18:1604664-1604686 ATAAATAAATACTAGGAGGCAGG - Intergenic
1153319389 18:3757420-3757442 ATAAATAAATAAATGGTGCAAGG + Intronic
1153563142 18:6392552-6392574 ATAAATAAATAAATAGTGCTGGG + Intronic
1153701766 18:7701437-7701459 AAAAATAAAAAAAAGTAGCTGGG + Intronic
1153836923 18:8971657-8971679 ATAAATAAATAAAATTAGCCGGG - Intergenic
1154114178 18:11596763-11596785 ATAAAAAAATAGAAAGAGGCTGG + Intergenic
1154198952 18:12286232-12286254 AAAAATAAAAATAAAGAGCTTGG + Intergenic
1154351686 18:13589087-13589109 ATAAACAAATAAAAATAGCTGGG - Intronic
1154381213 18:13851756-13851778 AAAAATACAAAGAAGCAGCTAGG + Intergenic
1155033101 18:22001457-22001479 ATAAATAAATAAAAGAGGCAGGG - Intergenic
1155181437 18:23351732-23351754 ACAAAGAAACAGAAGGAGCGGGG - Intronic
1155456953 18:26027509-26027531 ATAAATAATTAAAATTAGCTGGG + Intronic
1155676309 18:28433289-28433311 TTTAATAAATAGATGGTGCTGGG - Intergenic
1156668641 18:39439906-39439928 ATAAGGAAATTGAAGGAGTTTGG + Intergenic
1157283226 18:46359722-46359744 AGCAATAAGTAGAAGGAGCCTGG - Intronic
1157425520 18:47581015-47581037 AGAAATAAAAAGAAGGGGGTGGG + Intergenic
1157819810 18:50758083-50758105 ATAAATAAATAAAACTAGCTGGG + Intergenic
1157838403 18:50930264-50930286 ATAAATAAATAAAAAGAGCATGG + Intronic
1158039021 18:53070138-53070160 ATAAACAAATAAAATTAGCTGGG - Intronic
1158218708 18:55128004-55128026 ATAAATAAATAAAACCAGATTGG + Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158302284 18:56065462-56065484 AAAAAAAAAAAAAAGGAGCTGGG - Intergenic
1158600189 18:58849927-58849949 ATAAATAAATAAAAATAGCTGGG - Intergenic
1159263684 18:66051050-66051072 ATAAATAAATAAACAGAGCATGG - Intergenic
1159457742 18:68683002-68683024 ATAAATAAATAAAAGGAGAGGGG + Intronic
1159724416 18:71936610-71936632 ATAGATAAATAGATAGATCTAGG - Intergenic
1159865535 18:73700196-73700218 ACATATAAATACAATGAGCTTGG - Intergenic
1160284818 18:77532128-77532150 ATAAATAAATAAAAGAAGAAGGG - Intergenic
1160363013 18:78300097-78300119 ATTGAGAAATAGGAGGAGCTGGG + Intergenic
1160766196 19:809299-809321 ATAAATAAATAAATGTGGCTAGG - Intronic
1160896744 19:1406520-1406542 TTAAATAAATACAAGGAACAAGG - Intergenic
1160917046 19:1501888-1501910 GTAAATAAATAAAAAGAGCTGGG - Intergenic
1161539637 19:4842437-4842459 ATAAATAAATCAAATTAGCTGGG + Intronic
1161540797 19:4850237-4850259 TTAAATAAATACATGCAGCTGGG - Intronic
1161913099 19:7209163-7209185 ATAAATAAATAAAATTAGCTGGG + Intronic
1161919316 19:7254366-7254388 ATAAGTAAATAAAATTAGCTGGG + Intronic
1162181635 19:8873112-8873134 ATAAATAAATAGCAAGTGATGGG - Intronic
1162311190 19:9908283-9908305 AAAAATAAAAAGAATTAGCTGGG - Intronic
1162333249 19:10043507-10043529 GTAAATAAATATACGGAGTTGGG + Intergenic
1162350677 19:10147284-10147306 ATAAATAAATAAAAGAGGTTGGG + Intronic
1162390804 19:10388921-10388943 ATAAATAAATAAAAAGATCTTGG + Intergenic
1162425832 19:10594910-10594932 ATAAAAAAATAAAATTAGCTGGG - Intergenic
1162474705 19:10893033-10893055 ATAAATAAATAAAATGGGCAGGG - Intronic
1162580629 19:11528012-11528034 ATAAATAAATAAAATCAGATAGG + Intronic
1162734100 19:12736284-12736306 ATAAATAAATAAAATAGGCTGGG - Intergenic
1162902643 19:13804484-13804506 ATAAATAAATAAAATTAGCCGGG + Intronic
1163113026 19:15172945-15172967 AGAAAGAAATAGGAGGGGCTCGG - Intronic
1163160119 19:15459232-15459254 ATAAATAAATAAATAGGGCTGGG - Intronic
1163270734 19:16251990-16252012 ATAAATAAATAAAAATACCTGGG - Intergenic
1163297780 19:16423410-16423432 ATAAATAAATAAAATTAGCTAGG + Intronic
1163354670 19:16802297-16802319 AAAAATAAAAATAATGAGCTGGG + Intronic
1163498305 19:17660054-17660076 ATAAATAAATAAAATTAGCTGGG - Intronic
1163502217 19:17683071-17683093 ATAAATAAATAGAAAGAAGAAGG + Intronic
1164031162 19:21406955-21406977 ATAAATCAATAAAAGGAATTAGG - Intronic
1164061020 19:21673717-21673739 ATAATTAATTATAAGGAGGTGGG + Intergenic
1164559756 19:29282424-29282446 ATAAATAAATAAATAAAGCTAGG + Intergenic
1164572235 19:29382782-29382804 ATAAACAAGGAGAAGGAGCTTGG - Intergenic
1164628273 19:29743882-29743904 AAAAATAAAAAAAAGTAGCTGGG + Intergenic
1164806040 19:31117701-31117723 ATAAATAAATAAAATAATCTAGG + Intergenic
1164957428 19:32398614-32398636 ATAAATAAATAAAAGAAGTTTGG + Intergenic
1164981033 19:32614697-32614719 ATAAATAAATAAAAAGAACAAGG + Intronic
1165604320 19:37087329-37087351 ATAAATAAAAATTAAGAGCTTGG + Intronic
1165774808 19:38398213-38398235 ATAAATAAATAGGAAGAGAAGGG - Intergenic
1165801277 19:38552106-38552128 ATAAATAAATAAAAGTAGCCGGG - Intronic
1165804169 19:38570475-38570497 ATAAATAAATAGGAGGTTGTAGG + Intronic
1166061759 19:40330185-40330207 ATAAATAAATAAAAAGAGAAGGG - Intronic
1166665062 19:44674559-44674581 ATAAATAAAAAAAATTAGCTGGG - Intronic
1166682148 19:44775596-44775618 ATAAATAAATAGATTGGGCCGGG - Intergenic
1166735928 19:45084741-45084763 ATAAATAAATAAAATTAGCTGGG - Intronic
1166780135 19:45337830-45337852 AGAAAGAAATAGCTGGAGCTTGG + Intronic
1166797013 19:45432700-45432722 AAAAATAAATAAAAGCAGCCAGG - Intronic
1167010127 19:46801728-46801750 AAAAAAAAAAAGAAGAAGCTGGG - Intergenic
1167081345 19:47278147-47278169 AAAAAAAAAAAGAACGAGCTGGG - Intergenic
1167224298 19:48226935-48226957 ATAAAAAAATACAAATAGCTGGG + Intronic
1167256681 19:48434412-48434434 AAAAATAAAAAGAACTAGCTGGG - Intronic
1167313680 19:48751957-48751979 AAAAATAAATAAAATTAGCTTGG + Intronic
1167370910 19:49081315-49081337 ATAAATAAAGAGAGGCAGCCAGG + Intergenic
1167541160 19:50088062-50088084 ACAAATAAATAAAAGGTACTTGG + Intergenic
1167576202 19:50319050-50319072 ATACATGAATGAAAGGAGCTAGG + Intronic
1167628930 19:50611425-50611447 ACAAATAAATAAAAGGTACTTGG - Intergenic
1167811359 19:51834236-51834258 ATAAATAAATAAAAGGAGTGTGG - Intergenic
1168000271 19:53440166-53440188 ATAAATAAATAAAATGAACCAGG + Intronic
1168615177 19:57831687-57831709 ATAAATAAATAAAATAAGCTGGG - Intronic
1168618990 19:57861928-57861950 ATAAATAAATAAAATTAGCCAGG - Exonic
1168704907 19:58464883-58464905 ATACAAAAATAAAAGTAGCTGGG - Intergenic
925739576 2:6993869-6993891 ATATATAGATACTAGGAGCTTGG - Intronic
925936700 2:8770243-8770265 AAAAATAAAAAGAAAGAGCCAGG + Intronic
926041201 2:9674635-9674657 ATAAATAAATAAAACAAGTTGGG + Intergenic
926718993 2:15944868-15944890 AGAAATAAATATAAAGAACTTGG - Intronic
926779124 2:16451385-16451407 ATAACAAAATAGAAGGAGCCTGG + Intergenic
926893294 2:17657597-17657619 ATAAATAAAATGTAGAAGCTGGG + Intergenic
926898120 2:17717684-17717706 TTAAAAAAATAGAAGAGGCTGGG + Intronic
927017347 2:18978980-18979002 ATAAATAAATAAAAGGAGGAGGG - Intergenic
927405353 2:22760324-22760346 GTAAATAAATACACAGAGCTGGG - Intergenic
927581606 2:24255629-24255651 AAAAATAAATAAAAAGGGCTGGG + Intronic
927681534 2:25142783-25142805 ATAAATAAATAAAATTAGCCAGG + Intronic
927970055 2:27299966-27299988 AAAAATAAATAAATGGAGCTGGG - Intronic
928418265 2:31115087-31115109 ATAAATAAATAAAATTAGCCAGG + Intronic
928544461 2:32316279-32316301 ATAAATCAATAAAATGGGCTAGG + Exonic
928546412 2:32333098-32333120 AAAAATAAATAGAAGAGGCTGGG + Intergenic
928547737 2:32343792-32343814 ATAAATAAATAAAAAGGGCTGGG + Intergenic
928553103 2:32393678-32393700 AAAAATAAACAGAATTAGCTGGG - Intronic
928645909 2:33352423-33352445 ATTAATAAATAGACAGAGTTGGG - Intronic
928826092 2:35423031-35423053 ATATATCAATGAAAGGAGCTTGG + Intergenic
929004167 2:37379386-37379408 AAAAATAAAAAAAAGTAGCTAGG + Intergenic
929559049 2:42944243-42944265 ATAAAAAAATAGAGTGTGCTTGG - Intergenic
930106769 2:47646430-47646452 ATAAATAAATAAAAAGGGCTTGG + Intergenic
930251808 2:49042909-49042931 ATAAAAAAATAGACGGTGCCTGG - Intronic
930278457 2:49341190-49341212 AAAAATACATAAAATGAGCTGGG - Intergenic
930410806 2:51024545-51024567 ATAAATAAATAAAACTTGCTAGG + Intronic
930596030 2:53389097-53389119 ATAAATAAATAAAAGAAATTTGG + Intergenic
930979936 2:57511337-57511359 ATAAATAAATAGACAGACCTTGG + Intergenic
931386637 2:61803823-61803845 ATAAATAAATAAAAAGAGGCTGG + Intergenic
931443270 2:62306252-62306274 AAAAAAAAATAGAATTAGCTTGG - Intergenic
931977859 2:67663121-67663143 ATATATAGAGAGAAGAAGCTAGG - Intergenic
932198969 2:69809196-69809218 ATAAGTAAAAAGAAGGGGCAAGG - Intronic
932256755 2:70294295-70294317 ATAAATAAATAAAAAAAGCCGGG + Intergenic
932642099 2:73459535-73459557 ATAAATAAATAAATGGAGAAGGG - Intronic
932790830 2:74653478-74653500 AAAAAAAAAAAGAAGGAGCTAGG + Intergenic
933836276 2:86248408-86248430 ATAAATAAATAAAATAAACTAGG - Intronic
933915024 2:86981617-86981639 ATAAAGAAAGAAAAGGAGTTTGG + Intronic
933978059 2:87527853-87527875 ATAAATAAATAGATGTTGCTGGG + Intergenic
934007970 2:87788283-87788305 ATAAAGAAAGAAAAGGAGTTTGG - Intronic
935105198 2:100036264-100036286 ATTATTAAGTAGAAGGACCTGGG - Intronic
935753128 2:106256477-106256499 ATACATAAATAAAATTAGCTGGG + Intergenic
935771608 2:106429207-106429229 ATAAAGAAAGAAAAGGAGTTTGG - Intronic
935908463 2:107866742-107866764 ATAAAGAAAGAAAAGGAGTTTGG + Intronic
935913551 2:107924012-107924034 ATACATAAATAAAATTAGCTGGG + Intergenic
935994866 2:108758965-108758987 ATAAAGAAAGAAAAGGAGTTTGG + Intronic
936130252 2:109831869-109831891 ATAAAGAAAGAAAAGGAGTTTGG + Intronic
936214445 2:110539616-110539638 ATAAAGAAAGAAAAGGAGTTTGG - Intronic
936315774 2:111422950-111422972 ATAAATAAATAGATGTTGCTGGG - Intergenic
936371066 2:111902797-111902819 ATAAAGAAATAGAGGGAGGGAGG - Intronic
936423581 2:112394179-112394201 ATAAAGAAAGAAAAGGAGTTTGG - Intronic
936599540 2:113882190-113882212 AGATATAAGTAGAAGTAGCTTGG - Intergenic
936713049 2:115155050-115155072 AAAAATAAATAAAATTAGCTTGG - Intronic
937122422 2:119450093-119450115 ATAAATAAATAAATGGAGGGAGG + Intronic
937490391 2:122360842-122360864 ATTATTAGATAGTAGGAGCTTGG + Intergenic
937793462 2:125987958-125987980 ATAAATAAATAAATAGTGCTTGG - Intergenic
938483898 2:131683376-131683398 TTAAAAAAATAGGAGGGGCTGGG - Intergenic
938601780 2:132849867-132849889 ATTAAGGAATAGAAAGAGCTTGG - Intronic
938603965 2:132873262-132873284 AAAAATAAATAAAATGAGCTGGG - Intronic
938751342 2:134333595-134333617 ATAAAAAAAAAGAAGGTGGTGGG + Intronic
938835984 2:135104726-135104748 ATAAATAAATAAAATTAGCTGGG + Intronic
938867677 2:135440638-135440660 GTGAACAAAAAGAAGGAGCTTGG + Intronic
939110402 2:137999917-137999939 ATAAAAAAAAAAAAGAAGCTTGG + Intronic
939708281 2:145482074-145482096 ATAAATAAAGAGAAAAAGCTTGG - Intergenic
939766753 2:146260203-146260225 CTAAATATAAAGAAGAAGCTGGG - Intergenic
939786828 2:146524903-146524925 ACAAATAAATAGAAGTAGGCGGG - Intergenic
940345579 2:152624468-152624490 ATAAATAAATAAAAGGGGCGGGG - Intronic
940702907 2:157068763-157068785 ATAAATATATAGCAGGATCTAGG + Intergenic
940717180 2:157239252-157239274 ATTTATAATTAGAAGGAGCAAGG - Intergenic
941320329 2:164046647-164046669 ATAAATAAATAAAATTAGCCGGG - Intergenic
941668604 2:168266642-168266664 ATAAATAAATAAAATTAGCCAGG - Intergenic
942120064 2:172767969-172767991 AAAAATAAAAAAAATGAGCTGGG - Intronic
942194697 2:173505741-173505763 ATATATTAATAGAAGGTGCCTGG - Intergenic
942347334 2:175017145-175017167 ATAAAGAAATACCTGGAGCTGGG - Intergenic
942552310 2:177132014-177132036 ATATAGCAATAGATGGAGCTTGG + Intergenic
943186472 2:184613578-184613600 ATTAATAAAAAGAAAGAGATGGG + Intronic
943254347 2:185574821-185574843 ATAAACAAATAGAAGGTGACTGG - Intergenic
943368047 2:186983824-186983846 ATAAATAAATAAAATGTGATGGG - Intergenic
943782368 2:191838595-191838617 AAAAATAAATAAAAGGAGCATGG + Intronic
943932848 2:193877183-193877205 ATAAATAAATAAAAAGAAATTGG + Intergenic
943955320 2:194181273-194181295 ATAAATAAATGGAAAGATTTAGG - Intergenic
944070717 2:195665321-195665343 ATGAATAAATAAAATTAGCTGGG + Intronic
944214484 2:197240467-197240489 AAAAATTAAGAGAAAGAGCTGGG + Intronic
944232686 2:197411947-197411969 AAAAATAAATAAAAATAGCTGGG + Intronic
944407075 2:199397017-199397039 ATAACAAAATAAAAGGTGCTAGG + Intronic
944654480 2:201864258-201864280 ATAAAAGAAAAGAAGGAACTAGG + Intronic
944841449 2:203627844-203627866 ATAAATAAATAAAAGGAGGTGGG - Intergenic
945181314 2:207094341-207094363 ATAAATAAATAAAAGGAAACAGG - Intronic
946214165 2:218170826-218170848 ATAAATAAATAAAGTGAGCCTGG + Intergenic
946367122 2:219255225-219255247 ATAAATAAATAAAATAAGCTGGG - Intronic
946373209 2:219293157-219293179 ATAAATAAATAAATGCAGTTTGG - Intronic
946379242 2:219333326-219333348 ATAAATAAATAAAATTGGCTGGG - Intergenic
946457113 2:219836275-219836297 AAAAATAAAGAAAAGTAGCTGGG - Intergenic
947192035 2:227516719-227516741 ATAAATAAAATGAAGCAGATGGG - Intronic
947217828 2:227765462-227765484 ATAAATAAATTGTGGGAGCCAGG - Intergenic
947403127 2:229748681-229748703 AAAAAAAAATAGAAGAAGTTTGG + Intergenic
947529154 2:230897766-230897788 ATAGATAAATAGATGGAGTCTGG - Intergenic
947535467 2:230937997-230938019 AAAAATAAATAAAATTAGCTGGG + Intronic
947711296 2:232317730-232317752 ATTAAAAAATAGAAGAGGCTAGG - Intronic
948168698 2:235882971-235882993 ATAAATAAATAAAATTAGCTGGG - Intronic
948227302 2:236321143-236321165 ATAAATAAATAAAAGTATGTAGG - Intergenic
948298169 2:236879909-236879931 ATAAATAAATACAAGAAGAAAGG - Intergenic
948934733 2:241155903-241155925 AGAATTAAATAAAAGGAACTGGG - Intronic
1169163469 20:3403057-3403079 ATAAATTAACAGAATGACCTAGG - Intronic
1169781035 20:9310727-9310749 ATAAATAAAAAAAGGGAGCAGGG + Intronic
1169829298 20:9806123-9806145 ATAAATAAATAAAATTAGCTGGG - Intronic
1169964681 20:11203406-11203428 ATAAAGAAATACCAGGAACTGGG + Intergenic
1170030209 20:11936311-11936333 CTAAATAAATAAAATGAGCCAGG + Intergenic
1170222659 20:13957395-13957417 ATTAATAAATACAATGGGCTGGG - Intronic
1170412347 20:16105140-16105162 ATAGAAAAAGAGAAGGGGCTAGG - Intergenic
1170834219 20:19869783-19869805 ATAAATAAATAAAATTAGCCAGG - Intergenic
1171979531 20:31617787-31617809 AAAAAAAAAAAGAAGGAGATGGG - Intergenic
1172089974 20:32423532-32423554 ATAAATAAATAAAAAATGCTGGG - Intronic
1172254596 20:33506110-33506132 GAAAAGAAATAGAAGGGGCTGGG + Intronic
1172552414 20:35811738-35811760 ATAAATAAAAAGCAGGGACTGGG - Intronic
1172870664 20:38133625-38133647 GTAAATAAATACAAGTAGTTGGG + Intronic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1173082297 20:39879877-39879899 AAAAATAAATAAAAGGTACTAGG - Intergenic
1173169531 20:40712911-40712933 ATAAATAAATAAAAGGAGAAGGG - Intergenic
1173388402 20:42609436-42609458 ATAAATAAAGGCAAGGACCTAGG - Intronic
1173442981 20:43094690-43094712 ATAAATAAAGAGAAGAGGCCGGG - Intronic
1173640077 20:44595499-44595521 ATAAATAAATAAAAGTACTTGGG - Intronic
1173651445 20:44667889-44667911 ATAAATAAATAAAATGAAATTGG + Intergenic
1173679026 20:44863117-44863139 ATAAATAAAAAAAATTAGCTGGG + Intergenic
1173988250 20:47279444-47279466 ATAAATAAATAAAACAAGCCTGG + Intronic
1174014319 20:47475472-47475494 AAAAATAAATAAAATTAGCTGGG + Intergenic
1174076878 20:47943657-47943679 AGAAATGAACAGAAGGAGGTTGG - Intergenic
1174147854 20:48464591-48464613 ATAAATAAATAAAATGCTCTAGG - Intergenic
1175004068 20:55663671-55663693 AAAAATAAATAAAATTAGCTGGG + Intergenic
1175492530 20:59388855-59388877 ATAAATAAATAAAATTAGCTGGG + Intergenic
1175682159 20:60996859-60996881 TTAAATAATAAGAAGGAACTTGG + Intergenic
1175920581 20:62448880-62448902 ATAAATGAATAGAGGGTGCAGGG - Intergenic
1176512284 21:7757893-7757915 ATAAATAAATAAAAGGGGGGTGG + Intronic
1176850939 21:13913177-13913199 ATAAATAAATAAAAGATGTTGGG - Intergenic
1176942636 21:14942377-14942399 ATAAATAATTTAAATGAGCTGGG + Intergenic
1177070807 21:16504906-16504928 TTCAATAAATACAAGGAACTTGG - Intergenic
1177286753 21:19061576-19061598 ATAAATACATAAAAGGAGTAAGG - Intergenic
1177306851 21:19329537-19329559 ATAAATAAATAAATGAAGATGGG - Intergenic
1177328434 21:19625137-19625159 ATAAATAAATAAAAAGAGCTGGG - Intergenic
1177395980 21:20536790-20536812 ATAAACAAAAAGAATGAACTTGG + Intergenic
1177801140 21:25830152-25830174 ATAAATAAATAAAGTTAGCTGGG + Intergenic
1177928195 21:27246044-27246066 ATAAATAAATAGAAGTGGAATGG - Intergenic
1177936984 21:27361075-27361097 ATAACTACATAAGAGGAGCTTGG - Intergenic
1178170897 21:30038771-30038793 AAAAATAAAGAGAAGAAGATGGG + Intergenic
1178302886 21:31467662-31467684 ATAAATAAATAAAATTAGCCAGG + Intronic
1178341503 21:31789217-31789239 ATAAATAAATAAATGTAACTAGG - Intergenic
1178399250 21:32270094-32270116 ATAAATAAAAATAAAAAGCTGGG + Intronic
1178646396 21:34388417-34388439 ATAAATAAATAAAAGGGGGGTGG + Intronic
1178856866 21:36257630-36257652 ATAGATAGATAGAAGTAGTTAGG + Intronic
1178863509 21:36308864-36308886 ATAAATAAATAAAAGGAATTAGG - Intergenic
1178984243 21:37289402-37289424 TTAAATAAATATAGGCAGCTGGG - Intergenic
1179103743 21:38379851-38379873 ATAAATAAATACAAAAAGCCGGG - Intergenic
1179202764 21:39241527-39241549 CTAAATAAATAACAGGAGCCAGG + Intronic
1179626328 21:42651565-42651587 ATAAATAAATAGAATGTGTAGGG - Intergenic
1180226532 21:46396591-46396613 ATAAATAAATAAAATTAACTGGG - Intronic
1180646061 22:17340105-17340127 ATAAATAAACAAAATTAGCTAGG + Intergenic
1181032667 22:20155779-20155801 GAAAATAAATAAAATGAGCTTGG - Intergenic
1181144819 22:20837380-20837402 ATAAATAAATAGCAGAAGAAAGG + Intronic
1181384156 22:22531472-22531494 ATAAATAAATAAAATGGCCTAGG + Intergenic
1182588150 22:31358449-31358471 ATAAATAAAAAGAAGAATCGGGG + Intergenic
1182634194 22:31711487-31711509 ACAAATAAATAAAAGCAGCCTGG + Intronic
1182669856 22:31986829-31986851 AAAAATAAAAAGAATTAGCTGGG + Intergenic
1182970362 22:34568081-34568103 ATAAATCTAAAGAAGGAGATAGG + Intergenic
1182971153 22:34579043-34579065 ATATATAAATGGAAGAATCTAGG + Intergenic
1183240006 22:36650670-36650692 AAAAATAAATAGAATGGGCTAGG - Intronic
1183458360 22:37934889-37934911 ATAAATAAATAAATAGAGCCAGG - Intronic
1183507323 22:38216398-38216420 ATAAATAAATTCTAGGAGCCGGG - Exonic
1183539297 22:38420253-38420275 AAAAAAAAAAAAAAGGAGCTGGG - Intergenic
1183936815 22:41267340-41267362 AAAAAAAAATAAAAGGAGGTTGG + Intronic
1183991061 22:41597299-41597321 ATAAATGAGGACAAGGAGCTTGG + Intergenic
1184009804 22:41738805-41738827 ATAAATAAATAAAATTAGCTGGG + Intronic
1184020466 22:41817758-41817780 ATAAATAAATAAAAAGAGAGGGG + Intronic
1184116155 22:42423557-42423579 ATAAATAAATAAAATTAGCTGGG + Intronic
1184214109 22:43055017-43055039 AAAAACAAAAAGAAGGGGCTGGG - Intronic
949467354 3:4357568-4357590 ATAAATAAATAAAAGTTGGTTGG - Intronic
949823751 3:8142506-8142528 ACAGATAAATAGATGGAGATAGG + Intergenic
949995237 3:9611477-9611499 ATAAATAAATAAAATTAGCAGGG - Intergenic
950130086 3:10536685-10536707 AAAAATAAATAAAATTAGCTGGG - Intronic
950353690 3:12383583-12383605 ATAAATAAATAAAAACAGCATGG + Intronic
950473551 3:13201489-13201511 ATAAATAAATAAAATTAGCTGGG - Intergenic
951771409 3:26261700-26261722 TTAAACAAATAGAACCAGCTTGG + Intergenic
951960000 3:28307366-28307388 ATAAATAAAAAAAATTAGCTAGG + Intronic
952493237 3:33892312-33892334 ATAAATTAATAAATGGTGCTGGG - Intergenic
952511179 3:34057669-34057691 ATAAAGAAAGAAATGGAGCTAGG - Intergenic
953615299 3:44484809-44484831 ATAAAAAAATAAAATTAGCTGGG - Intergenic
953656366 3:44857996-44858018 GTAAATCAAGAGAAAGAGCTTGG + Intronic
953900953 3:46843673-46843695 ATAAATAAATAAAATTAGCCAGG - Intergenic
954128081 3:48543999-48544021 ATAAATAAATAAAAGGCGGGCGG - Intronic
954244370 3:49319026-49319048 ATAAATAAATAGAAATACATTGG + Intronic
954281892 3:49586321-49586343 ATAGATAGATAGATAGAGCTGGG - Intronic
954356639 3:50087643-50087665 ATAAATAAAAAGGAGGGGCCAGG - Intronic
954473884 3:50724830-50724852 ATATATAAAAAGAAATAGCTGGG + Intronic
954657135 3:52201597-52201619 AAAAATAAAAAGAATTAGCTGGG + Intronic
954736044 3:52707149-52707171 ATAAATAAATAAAAGGTGAAGGG - Intronic
954738297 3:52725573-52725595 ATCAATAACTAGAAGGATTTGGG + Intronic
954769800 3:52956463-52956485 ATAAATAAATACAATAGGCTGGG + Intronic
954853554 3:53623890-53623912 ATCAATAAGTAGAAGGAGATTGG + Intronic
956263206 3:67368500-67368522 ATAAAGAAATTAAAGGAACTAGG - Intronic
956721616 3:72122947-72122969 ATAAATAAATAAAATTAGCTGGG + Intergenic
956810673 3:72861332-72861354 ATAAATAAATAAAAGAATATAGG - Intronic
957479602 3:80774462-80774484 ATAAATGAATGAAATGAGCTAGG - Intergenic
957735380 3:84196155-84196177 ATAAATAAATAAAATTAGCCAGG - Intergenic
957796428 3:85014919-85014941 AAAAAGAAATAGAAGGATATAGG - Intronic
957938102 3:86969666-86969688 ATAAATAAATAAAATGAGGTTGG - Intronic
958196330 3:90246007-90246029 ATAAATAAATAAAAGGAGCCAGG - Intergenic
958408067 3:93772986-93773008 ATAAATAAAGGGAAAGAACTGGG + Intergenic
958419518 3:93914649-93914671 ATAAATAAATAAAAGGAGCCAGG - Intronic
958649264 3:96916578-96916600 ATAGAAAAAAACAAGGAGCTGGG + Intronic
958954309 3:100450893-100450915 ATAAATAAATAGAGAGAGAGAGG + Intronic
959164040 3:102754541-102754563 ATAAATAAATGATAGAAGCTAGG + Intergenic
959274339 3:104258755-104258777 AGAAATAAATTGAATGAACTTGG + Intergenic
959292718 3:104494854-104494876 ATAAATAAATAAAAATAGCAGGG - Intergenic
959401139 3:105903716-105903738 AGAAATAAATAGAAGGGGCGGGG - Intergenic
959531334 3:107437725-107437747 ATAAATAAATAAAATTAGCCAGG - Intergenic
959552452 3:107678206-107678228 AAATATAAACAGCAGGAGCTTGG - Intronic
959803190 3:110520217-110520239 ATAAATAAATAAAAATAGCTGGG - Intergenic
959870291 3:111319212-111319234 ATAAATAAATAAATAGTGCTGGG + Intronic
959890293 3:111547315-111547337 ATATATAAAAAGAAGGAGCAGGG - Intronic
959916858 3:111826146-111826168 AAAAATAAAAAGAATTAGCTAGG + Intronic
960615812 3:119595139-119595161 ATAAATAAATAAAATTAGCTGGG + Intergenic
960651499 3:119956117-119956139 ATTAGTAAATAGAAGGAGGGAGG + Intronic
960793453 3:121458409-121458431 ATAAATAAATAAAAGGAAGTCGG + Intronic
960805123 3:121576326-121576348 ATAAATAAATAAATTGAGTTTGG - Intronic
960967117 3:123113015-123113037 ATTAATAAAGAGAAGGAGCGAGG - Intronic
961256358 3:125557362-125557384 ATAAATAAAAATAAAGAGCCTGG - Intronic
961564280 3:127752501-127752523 ATGATTAAAAAGAAGGAGTTAGG - Intronic
961653743 3:128430178-128430200 AGCAAGAAACAGAAGGAGCTGGG + Intergenic
962201909 3:133407084-133407106 ATAAATAAATAAATGCTGCTGGG + Intronic
962470896 3:135707541-135707563 ATAAATAAATAAGAGGACGTGGG + Intergenic
962604791 3:137024185-137024207 ATAAATAAAAAGAAGGAGGAAGG - Intergenic
963169520 3:142236742-142236764 ATAAATAAATAAATGTGGCTGGG - Intergenic
963313751 3:143736261-143736283 ACAAATAGATAGAAGGAAGTAGG - Intronic
963353517 3:144181329-144181351 CTAAATAGACAGAAGGAACTTGG - Intergenic
963613196 3:147498851-147498873 ATAAATAACAAGAAGGAGTTGGG - Intronic
963646857 3:147925912-147925934 CTAAATATCTAGAAGGAGTTTGG + Intergenic
963795218 3:149624858-149624880 ATAAATAAAATGAATTAGCTGGG - Intronic
963976914 3:151490708-151490730 ATAAATAACAAGAAGAATCTTGG + Intergenic
964342878 3:155727159-155727181 ATAAAAAAATAAAATGAGCTTGG + Intronic
964465801 3:156990599-156990621 ATAAATAAATAGATGAAGGTAGG - Intronic
964666825 3:159183693-159183715 ATAAAAAGATGGAAGAAGCTTGG - Intronic
964690701 3:159446333-159446355 AGAAACAAATAGAAAGAGGTGGG + Intronic
964755474 3:160087719-160087741 ATAAATAAATAAAATGAAGTGGG - Intergenic
964793210 3:160471970-160471992 ATAAATGAAGAGAAGAATCTGGG - Intronic
964856296 3:161149657-161149679 AAAAATAAATAAAGTGAGCTGGG - Intronic
964942999 3:162184689-162184711 ATGAATAAAAATAAAGAGCTAGG - Intergenic
965011204 3:163094667-163094689 ATAAATAAATAAAAGAAGTTTGG - Intergenic
965480816 3:169217492-169217514 ATAAATAAATAGGCCGAGCACGG + Intronic
965546962 3:169926129-169926151 ATAAATAAATGCAAGTGGCTGGG - Intronic
965575777 3:170217166-170217188 ATAAGTAAATAGAAGAAGTGTGG - Intergenic
965624696 3:170674837-170674859 ATAAATCATGAGAAAGAGCTTGG + Intronic
965779026 3:172264145-172264167 ATAAATAAAAAGAATTAGCCAGG - Intronic
965816309 3:172640483-172640505 ATAAATAAATAAAGGGGGCAGGG - Intronic
966378034 3:179317049-179317071 AAAAATACAAAGAAGTAGCTGGG - Intergenic
966601893 3:181783908-181783930 ATAAATAAATAAAACTAGCCGGG + Intergenic
966843475 3:184107531-184107553 ATAAATAAATACAAGAAACTTGG + Intergenic
967033113 3:185626786-185626808 TAAAATAAATAGTAGTAGCTGGG + Intronic
967050106 3:185775027-185775049 AAAAAAAAAAAGAGGGAGCTGGG + Intronic
967216763 3:187217823-187217845 AGAAATAAACAGAATAAGCTGGG + Intronic
967499381 3:190179578-190179600 AAAAATAAATAAAATTAGCTGGG + Intergenic
967618915 3:191607792-191607814 AAAAATAAATAAAATGAGGTAGG + Intergenic
967683432 3:192392433-192392455 ATAAATAAATAAATAAAGCTGGG + Intronic
967794361 3:193583135-193583157 ATAAAAATAAAGAAGGGGCTGGG + Intronic
967895395 3:194391833-194391855 AAAAATAAAAAAAATGAGCTGGG - Intergenic
967954076 3:194863700-194863722 GTAAATAAATAGAACATGCTGGG + Intergenic
968385442 4:132226-132248 ATAAATAAATAAATGTAGTTTGG + Intronic
968542292 4:1173722-1173744 AAAAATAAATAGAAGCAACTAGG + Intronic
968627490 4:1633658-1633680 ATAAATAAATAAAATAAGCAAGG + Intronic
968986081 4:3875157-3875179 ATAAATAAATAAATGGGGGTGGG - Intergenic
969986424 4:11216125-11216147 ATGGATAAACAGAAAGAGCTTGG - Intergenic
970051181 4:11916720-11916742 ATAAAAATATGGAAGGAGTTTGG + Intergenic
970243806 4:14037363-14037385 ATAAATAAATATAGGGAGCTGGG + Intergenic
970405284 4:15757166-15757188 AGAAAGGAATAGGAGGAGCTTGG - Intergenic
970638694 4:18039071-18039093 GTAAACAAAGAGAAGGAGATTGG - Intergenic
970660897 4:18284676-18284698 GCAACAAAATAGAAGGAGCTTGG - Intergenic
970674921 4:18438223-18438245 AAAAAAAAAAAGAAGGAGCCTGG - Intergenic
970903434 4:21186933-21186955 TTAAATAAAAAGATTGAGCTGGG - Intronic
970977770 4:22060523-22060545 ACAGAAAAACAGAAGGAGCTGGG - Intergenic
971471243 4:27029151-27029173 AAAAATAAATAAAAATAGCTGGG - Intergenic
971703456 4:30009889-30009911 ATAAATCAATAAAAAGAACTTGG - Intergenic
971782394 4:31053727-31053749 ATAAATACATAAAAGGATGTGGG - Intronic
971988003 4:33851509-33851531 ATGAATAAATAGAAGAATCAAGG + Intergenic
972024739 4:34362655-34362677 ATAAATAAAAAAAAGGAGATGGG + Intergenic
972079558 4:35133674-35133696 ATAAATAAATAAATGAGGCTGGG + Intergenic
972189288 4:36570451-36570473 ATAAATAAATAAAAGTCCCTAGG + Intergenic
972433491 4:39007750-39007772 ATAAATAGACAGAAAGGGCTGGG - Intronic
972437675 4:39049524-39049546 AAAAATAAATAAAATTAGCTGGG + Intronic
972520583 4:39851634-39851656 AGAGATAAAAAGATGGAGCTAGG + Intronic
972617390 4:40712971-40712993 ATAAAAAAATAAAGTGAGCTAGG - Intergenic
972842045 4:42942783-42942805 ATAAGGAAATAGAAAGAGCAAGG - Intronic
972865010 4:43221250-43221272 ATAAATAACTACAAGTAGCCAGG + Intergenic
973117201 4:46476551-46476573 ATAAATAAATGCATGGAGATAGG - Intergenic
973128647 4:46621316-46621338 ATAAATAAATAAATAGTGCTGGG - Intergenic
973272502 4:48276003-48276025 ACAAAAAGACAGAAGGAGCTGGG - Intergenic
974049397 4:56926366-56926388 ATAAATAAATAAAAAAGGCTGGG - Intronic
974360893 4:60877643-60877665 ATAAATAAATAAGAAGAACTTGG + Intergenic
974430072 4:61785113-61785135 ATAAATAAATAAAGGGGGTTAGG + Intronic
974869710 4:67625665-67625687 AACAATAATTAGAAGGATCTTGG - Intronic
974938084 4:68431627-68431649 AAAAAAAAAAAGAAGGAGGTGGG + Intergenic
975259087 4:72275050-72275072 ATAAAAAAATAGAAATATCTTGG + Intergenic
975268400 4:72398412-72398434 ATAAATAAATAAAAATAGGTGGG + Intronic
975603157 4:76125128-76125150 AAAAATACAAAGAAGTAGCTGGG + Intronic
975634881 4:76438228-76438250 GTAAGAAAATAGAAGGAACTTGG - Intronic
975677542 4:76842124-76842146 ATAAATAAATAAAATTAGCTGGG - Intergenic
975863751 4:78704476-78704498 ATAAATAAATAGTGAGACCTGGG + Intergenic
975867185 4:78736253-78736275 ATTAAAAAATAGAATGAGATTGG - Intergenic
976008915 4:80463434-80463456 ATGAAGAACTAGAAGGACCTAGG - Intronic
976164473 4:82239853-82239875 ATAAATAAATATAAGCATCTTGG + Intergenic
976188403 4:82466046-82466068 AGAAATAAATAGAAAGAGGATGG - Intergenic
976196960 4:82542250-82542272 GTAAATAAATAGAATGGGCCAGG + Intronic
976638089 4:87308357-87308379 ATAAATAAATAGGCTGGGCTTGG + Intronic
976793878 4:88910941-88910963 ATAAAGAATTAAAAGCAGCTGGG - Intronic
977083036 4:92557722-92557744 ATAAATTTATAGAAGGGCCTTGG + Intronic
977250960 4:94688356-94688378 ATAAATCAATAGAAACAACTAGG + Intergenic
977437573 4:97018851-97018873 AAAAATAAATGGATGGGGCTGGG - Intergenic
977454278 4:97237839-97237861 ATAAATAAATAAAATCAGGTCGG + Intronic
977691116 4:99912211-99912233 ATAGATCAATAGAACGAGATAGG - Intronic
978222088 4:106289215-106289237 ATAAATACCTAGACAGAGCTGGG + Intronic
978335266 4:107660605-107660627 ATAAATGAGTATATGGAGCTTGG - Intronic
978475501 4:109124186-109124208 TTAAAGAAATATAAGGAGCAGGG - Intronic
978794172 4:112692340-112692362 ATAAATAAATGAAAGGAGTTAGG + Intergenic
978924115 4:114221918-114221940 ATAAATAAATAAAAAGATTTAGG - Intergenic
979067416 4:116156059-116156081 ATAAAGAAATAGAAACTGCTAGG - Intergenic
979169364 4:117581191-117581213 GAAAATAATTAGAAGGTGCTGGG + Intergenic
979532569 4:121784821-121784843 ACAAATAAGCAGAAGGAGGTGGG + Intergenic
979658431 4:123224150-123224172 ATAAATAAATAAATGGTGCTGGG - Intronic
980068769 4:128219819-128219841 ATAAATAAATAAATGGAATTAGG + Intronic
980348270 4:131653069-131653091 AAAAATAACTAGAATGTGCTGGG + Intergenic
980445944 4:132907647-132907669 AGAAATAAATAAAAGGTTCTTGG + Intergenic
980557257 4:134425176-134425198 ATAATTAAGTAAAAGGGGCTGGG + Intergenic
981176165 4:141686328-141686350 ATAAATAAATAAAAGGTGGGAGG + Intronic
981182671 4:141764083-141764105 ATAAATATAAAAAATGAGCTGGG + Intergenic
981295887 4:143131149-143131171 ATAAATAAATACAATGGGCCAGG + Intergenic
981308358 4:143269893-143269915 AAAAATACATAAAAGTAGCTGGG - Intergenic
981419734 4:144535391-144535413 ATAAATCAATAGAACGAGACTGG - Intergenic
981550001 4:145934501-145934523 CTAACTGAACAGAAGGAGCTGGG + Intronic
981572185 4:146164377-146164399 TTAAATAATTAAAAGTAGCTAGG + Intergenic
981673025 4:147309566-147309588 AAAAATAAATAAAGGAAGCTTGG - Intergenic
981957409 4:150494837-150494859 ATAAATAAATAAAATTAGCCAGG + Intronic
982147183 4:152407723-152407745 ATAAATAAATAGAGGGTGGGGGG - Intronic
982160151 4:152560767-152560789 ATAAATAAATAAAATTAGCTGGG + Intergenic
982230268 4:153202536-153202558 ATAAATAAATAAAATTAGCCGGG + Intronic
982302484 4:153894118-153894140 ATCAAGAAAGACAAGGAGCTGGG - Intergenic
982383827 4:154778915-154778937 ATAAAAAATTGGAAGGAGCCGGG - Intergenic
982389079 4:154844991-154845013 ATAAATATATTGAAGAAGTTGGG + Intergenic
982689695 4:158534027-158534049 ATAAATAATTGGAAGGAGTAAGG + Intronic
982746411 4:159107586-159107608 ATTATTAAATAGGAGGAGATGGG - Intronic
982992894 4:162301718-162301740 ATAAATAAATAAAATGAAATAGG - Intergenic
983159880 4:164399348-164399370 ATAAATAAATAAATGAAACTGGG - Intergenic
983165054 4:164465450-164465472 GCAAATAAATAGAAGGAGTTGGG + Intergenic
984628623 4:182037137-182037159 AAAAAAAAATAAAAGGAGTTTGG - Intergenic
984709986 4:182876731-182876753 ATAACTAAATACAAGGGACTGGG - Intergenic
984801451 4:183720942-183720964 ACAAATAAAGAGAAGGAATTAGG - Intergenic
985266707 4:188157897-188157919 AAAAATAAAAAGAATGAGCCAGG + Intergenic
986056808 5:4145965-4145987 ATCAATATATAGAAGGAAATGGG + Intergenic
986666522 5:10109332-10109354 ATAAATAAAAAGAAAGAGCTGGG - Intergenic
987014225 5:13801010-13801032 ATAAATAAATACAAGAAACCTGG + Intronic
987080856 5:14424053-14424075 ATAAATAAATAAAATGAAATGGG + Intronic
987132874 5:14874742-14874764 ATAAATAAATAAAAAGAGAGAGG - Intergenic
987705764 5:21460823-21460845 ATAAAAAAATAGAAAAGGCTGGG - Intergenic
987943479 5:24573158-24573180 ATAAATATATAAATAGAGCTCGG + Intronic
987977134 5:25028942-25028964 ATAAATAAATAAAAGTAGCAGGG + Intergenic
987988245 5:25177930-25177952 ATAAATAAGTAAAATGAGTTAGG + Intergenic
988230407 5:28470875-28470897 GTTAAGAAATAGAAGGAGCAAGG - Intergenic
988543114 5:32130134-32130156 ATAAAAAAATGGAAGTGGCTGGG - Intronic
988709817 5:33762211-33762233 ATAAAAAAATAAAAGAGGCTGGG + Intronic
988788792 5:34588406-34588428 ATAAATAAAAACAATTAGCTGGG - Intergenic
988889240 5:35596853-35596875 AAAAATTATTAGAAGAAGCTGGG + Intergenic
988982206 5:36582845-36582867 ATAAATAAATAAAATAAGCTGGG + Intergenic
989023046 5:37032612-37032634 ATAAATAAATAAAATTAACTGGG + Intronic
989047319 5:37285578-37285600 AAAAATAAATAAAAGTAGTTTGG - Intergenic
989074749 5:37552070-37552092 ATAAAAAAAAATATGGAGCTCGG - Intronic
989408291 5:41086982-41087004 ATAAATACATATAAGAATCTTGG - Intergenic
989535508 5:42559383-42559405 ACAAATAAATAAAAATAGCTAGG + Intronic
989602051 5:43209582-43209604 ATAAATAAATAAAGGTAGCATGG - Intronic
990397977 5:55403879-55403901 ATAAATAATTGAAAAGAGCTTGG + Intronic
990800691 5:59599379-59599401 ATAAATAAATAAAAATAGCTGGG - Intronic
990925556 5:61017731-61017753 ATAAATAAATACAAAGAGACAGG - Intronic
991027405 5:62045027-62045049 ATATATAAATAGAAGAAACAGGG + Intergenic
991184076 5:63787358-63787380 ATAAAGAAATAACAGAAGCTGGG + Intergenic
991225193 5:64262285-64262307 ATAAATAAGTAAAAGCAGTTTGG + Intronic
991380766 5:66023163-66023185 ATCATTAAATAAAAGGAGCAGGG - Intronic
991577516 5:68120522-68120544 ATAAATAAACAAAAGGAGATGGG - Intergenic
991761608 5:69921628-69921650 TTAAAAAAAAAAAAGGAGCTGGG + Intergenic
991785721 5:70196472-70196494 TTAAAAAAAAAAAAGGAGCTGGG - Intergenic
991840836 5:70796677-70796699 TTAAAAAAAAAAAAGGAGCTGGG + Intergenic
992110246 5:73486017-73486039 ATAAATAAATAAAAGAAACATGG - Intergenic
992177714 5:74166888-74166910 ATAAATAAATAAGAATAGCTAGG - Intergenic
992381742 5:76244075-76244097 ATAAATCAGTGTAAGGAGCTAGG - Intronic
992435276 5:76750216-76750238 ATGAAAAAATATAAGGGGCTGGG + Intergenic
992659653 5:78945768-78945790 ATAAATAAAGACAGGGAGGTTGG - Intronic
993045688 5:82863787-82863809 ATATATAAGGAGAAGGAGCCAGG - Intergenic
993148825 5:84133638-84133660 ATAAATAAATAAAATGAACAAGG + Intronic
993282603 5:85945944-85945966 TTAAATTGTTAGAAGGAGCTAGG + Intergenic
993581969 5:89674253-89674275 ATAAATGTAAAGAAGGAGCCAGG + Intergenic
993715504 5:91271904-91271926 ATAAATAAATAAAATTAGCTGGG + Intergenic
993812751 5:92503160-92503182 AAGAATAAAGAGAAGGAGCAAGG - Intergenic
994332525 5:98523802-98523824 ATAAATAAAAAGCAGATGCTAGG + Intergenic
994504348 5:100622561-100622583 ATAAATAAATAGATGGCAATGGG - Intergenic
994522820 5:100862943-100862965 AAAAATAAATACAAAGAACTTGG + Intronic
994741916 5:103629665-103629687 TTAAATATATAGAAAGAGCTGGG + Intergenic
994763407 5:103885242-103885264 GGAAATCAATACAAGGAGCTAGG + Intergenic
994910350 5:105897519-105897541 ATTAATAAACAGAAGGACATTGG + Intergenic
995033058 5:107500996-107501018 ATGAATAAATAGTAAGAGTTAGG - Intronic
995053797 5:107736552-107736574 ATAAATACATAGAAGGTAATTGG - Intergenic
995078721 5:108019348-108019370 ATAACTTAATAGTAGGTGCTGGG + Intronic
995574746 5:113517679-113517701 AAAAAAAGAGAGAAGGAGCTAGG - Intronic
995797170 5:115953822-115953844 AAGAATAAATAGTAGCAGCTGGG - Intergenic
996361338 5:122650324-122650346 AAAAAAAAATAGAATTAGCTAGG + Intergenic
996613928 5:125416708-125416730 AAAAATAAATAGAAAGATGTCGG - Intergenic
997033787 5:130162514-130162536 ATAAATAAATATAGGAATCTAGG - Intronic
997290682 5:132731652-132731674 AAAAATAAATTAAAGGAGATTGG + Intronic
997820189 5:137058668-137058690 AAAAATAAATAGGAGAAGGTAGG + Intronic
997948398 5:138222423-138222445 ATAAAGAATAAGAAGGGGCTGGG + Intergenic
998380643 5:141722716-141722738 GCAACAAAATAGAAGGAGCTTGG + Intergenic
998491282 5:142549005-142549027 AAAAAAAAATAGAAGGGGCCAGG - Intergenic
998807645 5:145934507-145934529 AGAAATTAATAGAAGGAGACAGG + Intergenic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
999028253 5:148259900-148259922 ATAAACAATTATAAGGAGGTTGG - Intergenic
999425309 5:151483062-151483084 ATAAATAAATAAAAGTAACTTGG + Intronic
999761573 5:154705357-154705379 ATAAATAAATAAAAAGAACAAGG - Intergenic
999909533 5:156182600-156182622 AAAAATAAAAAGAACAAGCTAGG + Intronic
999950761 5:156647639-156647661 ATACATAAATTGAAAGAGGTTGG + Intronic
1000037327 5:157459584-157459606 ATGAATAGATAATAGGAGCTTGG - Intronic
1000120216 5:158189973-158189995 ATAAATAAATACAAGAAAGTAGG - Intergenic
1000688814 5:164288509-164288531 AAAAATAAAAAAAATGAGCTGGG - Intergenic
1000762743 5:165246259-165246281 ATAAATAAACAGGAGGAGTGTGG + Intergenic
1000852455 5:166357226-166357248 ATAAATAAATATAAACTGCTTGG - Intergenic
1001034373 5:168287083-168287105 ATAAATAAAAAGAACCAGCAAGG + Intergenic
1001289480 5:170446618-170446640 ATAAATAAATAAAAATAGCTGGG - Intronic
1001690493 5:173629308-173629330 CTAAATAACAAGAAGGAGCTGGG + Intergenic
1002076917 5:176713762-176713784 ACAGATAAACAGAAGGAGCCTGG - Intergenic
1002172057 5:177380654-177380676 ATAAATAAATAAAAGAGGCTGGG - Intronic
1002272193 5:178079979-178080001 ATAAATAAATAAAATTTGCTGGG + Intergenic
1002468206 5:179418480-179418502 AAAAATACAAAGAAGTAGCTGGG + Intergenic
1003053515 6:2800011-2800033 ATACATAAGTAAATGGAGCTGGG + Intergenic
1003128304 6:3373592-3373614 CTAAATCAAAAGAAGAAGCTGGG + Intronic
1003166264 6:3681457-3681479 AGAAACAAAAAGAAGGACCTAGG - Intergenic
1003167126 6:3690030-3690052 AGAGATAAATAGGAGGAGCGGGG - Intergenic
1003366274 6:5477857-5477879 AAAAATAAAAAAAATGAGCTGGG + Intronic
1003587813 6:7409014-7409036 ATAAATAAATAAAAGAGGCCGGG - Intronic
1003888754 6:10544646-10544668 ATAAATAAATAAATGGGGCCGGG + Intronic
1004229835 6:13822218-13822240 AAAAATATATAGAAGAGGCTGGG + Intergenic
1004261639 6:14113091-14113113 ATAAATAAATAAATTTAGCTGGG - Intergenic
1004314262 6:14572348-14572370 ATAAACAAATAGTACAAGCTTGG + Intergenic
1004558973 6:16728905-16728927 AGGAATAAATAGAAGGAGAATGG - Intronic
1004569880 6:16834919-16834941 ATAAATAAATAAAAGGAGGGGGG - Intergenic
1004621380 6:17333447-17333469 ATAAATAAATAAAAGAATCAAGG - Intergenic
1004694030 6:18017570-18017592 TTAAATAAATAGAATGCGTTTGG + Intergenic
1004777789 6:18868051-18868073 AAAAATACAAAAAAGGAGCTGGG + Intergenic
1004972493 6:20926868-20926890 ATAAATATATAGAAACATCTTGG - Intronic
1005961009 6:30693162-30693184 AAAAAAAAAAAAAAGGAGCTGGG + Intergenic
1006107523 6:31725322-31725344 AAAAAAAAAAAAAAGGAGCTAGG - Intronic
1006138343 6:31910996-31911018 ATAAATAAATAAAATGAATTGGG + Intronic
1006356590 6:33562650-33562672 ATAAATAAATAAAATTAGCACGG - Intergenic
1006467415 6:34203983-34204005 AAAAATAAATTTAAGTAGCTGGG + Intergenic
1006539849 6:34730652-34730674 ATAAATAAATAAAATTAGCTGGG + Intergenic
1006653226 6:35568457-35568479 ATAAATAAATAGGCTGGGCTCGG - Intergenic
1006683938 6:35816382-35816404 ACAAATTACTAGAAAGAGCTGGG + Intronic
1006829459 6:36959898-36959920 ATAAATAAATAAAAAGGGGTGGG + Intronic
1006859310 6:37159466-37159488 ATAAATAAATAAAAGTGGCAGGG + Intergenic
1007185524 6:39968215-39968237 ATAAAAAAATAGAAAAGGCTGGG + Intergenic
1007490063 6:42213677-42213699 ATAAACATCTAGAAGGAACTTGG - Intronic
1007611768 6:43154178-43154200 ATAAATAAATAAAATTAGCATGG + Intronic
1007908233 6:45485996-45486018 AAAAATAAATAAAAGGTGATGGG - Intronic
1008172344 6:48223886-48223908 ATAAATAAATGAAAAGACCTGGG - Intergenic
1009022522 6:57960050-57960072 ATAAAAAAATAGAAAAGGCTGGG + Intergenic
1009404593 6:63296634-63296656 ATATATAAATTGAAGGAATTGGG + Intronic
1009414449 6:63399854-63399876 ATAAATAAAAAAAAATAGCTGGG - Intergenic
1009513257 6:64580003-64580025 ATAAATAAATATAATGTGCCTGG - Intronic
1009586212 6:65607469-65607491 AAAAATAAATAGAAGGCGTGAGG - Intronic
1009586622 6:65615367-65615389 ATAAATAAATAAAATGAACTCGG - Intronic
1009802971 6:68565938-68565960 ATAATTAAATAGAAAATGCTTGG + Intergenic
1010092028 6:71994135-71994157 AAAAATAAACAAAAGTAGCTAGG - Intronic
1010249007 6:73689063-73689085 ATTAATTAACAGAAGCAGCTGGG - Intergenic
1010331933 6:74633460-74633482 TTAAATAAAAAGAAGGAACATGG - Intergenic
1010371383 6:75112415-75112437 AGAAATAAAAAGAACGATCTAGG - Intronic
1010719392 6:79264710-79264732 ATACATAAAAAGAATAAGCTTGG - Intergenic
1010940700 6:81914337-81914359 ATAAACAAATAGAAGAAAATGGG + Intergenic
1010996245 6:82536755-82536777 ATAATGAAATAGAAGCAGCTAGG + Intergenic
1011142016 6:84168723-84168745 ATTTATCAATAGAAGGAGTTTGG - Intronic
1011175075 6:84551239-84551261 ATAAATAAATAAATGGAATTGGG - Intergenic
1011175633 6:84557028-84557050 ATAAATAAAGAAAAGTAGATGGG - Intergenic
1011561194 6:88617805-88617827 ACAAATAAATAGAAAGACATTGG - Intronic
1011573029 6:88760972-88760994 AAAAAAAAATAGAATGAGCTGGG - Intronic
1012011502 6:93792373-93792395 AAAAATAAATACAGGTAGCTGGG - Intergenic
1012320545 6:97839409-97839431 ATGAAGAAATAAAAGGAGTTGGG + Intergenic
1012426837 6:99124135-99124157 ATAAATAAATAAAAGAAGGCAGG - Intergenic
1012468976 6:99548516-99548538 AAAAATCAATAGAAGGGGCTGGG + Intronic
1012756920 6:103243318-103243340 ATAAATGAAGAGAAAGAGCTAGG + Intergenic
1013091840 6:106907277-106907299 ATAAATAAATAAAATTAGCCAGG + Intergenic
1013131444 6:107237226-107237248 ATAAATAAATAAAAGAGGCCAGG - Intronic
1013198448 6:107866803-107866825 ATAAATAAATACAATGAGCCAGG + Intergenic
1013212652 6:108000707-108000729 ATAAATAAATAAAAGAGGCTGGG + Intergenic
1013221833 6:108084552-108084574 ATAAATAAATAAAAGTAACTTGG - Intronic
1013258823 6:108416935-108416957 ATAAATAAATAAAGGGGCCTGGG + Intronic
1013845154 6:114441458-114441480 ATAAAGAGCAAGAAGGAGCTGGG + Intergenic
1014368418 6:120574563-120574585 ATAAATAATTAGAAGAAACAAGG + Intergenic
1014429779 6:121354480-121354502 ATAAATAAAAAGAAGGAGAAAGG + Intergenic
1015279095 6:131413352-131413374 ATAAAGGACTAGAGGGAGCTGGG + Intergenic
1015515507 6:134079085-134079107 TAAAATAAATATAAGGGGCTGGG + Intergenic
1015563654 6:134543120-134543142 TTGAATAAATACAAGAAGCTTGG + Intergenic
1015680275 6:135799764-135799786 ATAAATGAATACTAGGAACTAGG - Intergenic
1015767399 6:136733157-136733179 AAAAATAAATAGAATTAGCTGGG - Intronic
1015839588 6:137462352-137462374 ATAAATAAATAAAACCAGCAAGG + Intergenic
1015861239 6:137682501-137682523 ATAAATAAATAAAAAGAATTGGG - Intergenic
1015867129 6:137738993-137739015 TTAAATAAATATAAGAATCTAGG + Intergenic
1015884008 6:137897604-137897626 ATAAATAAATAAAATGGGCCAGG - Intergenic
1015885734 6:137916140-137916162 TAAAATAAATAGAAGGAGGCAGG + Intergenic
1015986937 6:138894044-138894066 ATAATTAAAAAGAAAGAGCTTGG - Intronic
1016118983 6:140324506-140324528 ATAAATAAATAACAGGATTTGGG - Intergenic
1016599821 6:145845685-145845707 ATAAATAAATGAAAATAGCTGGG + Intergenic
1017119980 6:151015097-151015119 ATAAACAAACAGAAAGAACTGGG - Intronic
1017300274 6:152849591-152849613 ATCAAGAAAATGAAGGAGCTGGG + Intergenic
1017774499 6:157670282-157670304 ATAAATAAATAAAAAGTACTTGG - Intronic
1018069661 6:160152858-160152880 ATAAATAAATAAAATTAGCCAGG - Intronic
1018308130 6:162479770-162479792 AAAAATAATTAGTAGGAGCCAGG + Intronic
1018449249 6:163891668-163891690 ATAAATACATAGCATGATCTGGG + Intergenic
1018498817 6:164380382-164380404 ATAAATAAATAAAATCAGCCAGG - Intergenic
1018536218 6:164822830-164822852 ACGAAAAAATAGAATGAGCTGGG + Intergenic
1019426815 7:981870-981892 ATAAATAAATAAAGTTAGCTAGG + Intergenic
1019650419 7:2154643-2154665 ATAAATAAATAAAAGAAAATGGG + Intronic
1020163455 7:5789910-5789932 ATAAATAAATAAAAGAGGCTAGG + Intergenic
1020231543 7:6322825-6322847 ATAAATAAAGAGCTGCAGCTGGG + Intergenic
1020332451 7:7033198-7033220 ATATAAAAATAGAAGCAGCAGGG - Intergenic
1020561470 7:9732735-9732757 ATTAATAAATAGAGGGGGCCGGG - Intergenic
1020585148 7:10055998-10056020 ATAAATAAATAAAAAGATTTGGG - Intergenic
1020988634 7:15168335-15168357 ATAAATAAATAAAAAGGGCGGGG + Intergenic
1021223627 7:18002423-18002445 ATTAATAAATAATATGAGCTTGG - Intergenic
1021565071 7:22008760-22008782 ATCAATAAAAAGAAGGAAGTGGG + Intergenic
1021589081 7:22241388-22241410 CTAAATAAATAGAGGGGGCAGGG + Intronic
1021645408 7:22784800-22784822 ATAAATAAAAACAAATAGCTGGG + Intergenic
1021726151 7:23549883-23549905 ATAAAGAAAAAGAAGGAGGCCGG - Intergenic
1021976639 7:26017679-26017701 AAAAAAAAAAAGAATGAGCTGGG + Intergenic
1021993926 7:26161712-26161734 AGAAAATAATAAAAGGAGCTAGG - Intronic
1022047609 7:26635209-26635231 ATAAAGAAATATAAGTGGCTGGG + Intergenic
1022061677 7:26802877-26802899 ATAAATAAATAAATGCTGCTTGG + Intronic
1022328485 7:29355264-29355286 AAAAATAAATAAAAGTGGCTGGG - Intronic
1022475798 7:30708727-30708749 AAAAAAAAAAAGAAGAAGCTGGG - Intronic
1022742220 7:33133584-33133606 ATAAATAAATAAAAGCATATAGG - Intronic
1023024231 7:36036443-36036465 AAAAAAAAAGAAAAGGAGCTGGG - Intergenic
1023317587 7:38956061-38956083 ATAAATAAATAAAATTAACTGGG - Intergenic
1023679174 7:42666530-42666552 AAAAATAAATAAAAGCAGCATGG + Intergenic
1023717129 7:43055876-43055898 ATAAATAAAAACAATGGGCTGGG + Intergenic
1023959884 7:44917425-44917447 ATAAATAACTAAAATTAGCTGGG - Intergenic
1024067570 7:45753861-45753883 ATAAATAAATAGAAATGGATAGG - Intergenic
1024164635 7:46718703-46718725 AAAAATAAAAAAAAAGAGCTGGG + Intronic
1024636442 7:51294480-51294502 AAAAAAAAATAAAAGTAGCTGGG + Intronic
1025081263 7:55985584-55985606 ATAAATAAATAAAACTAGCCAGG + Intronic
1025195024 7:56925908-56925930 ATAAATAAATAAAAGGAATTTGG + Intergenic
1025676928 7:63651035-63651057 ATAAATAAATAAAAGGAATTTGG - Intergenic
1025794158 7:64722512-64722534 AAAAAAAAAAAGAAGAAGCTAGG - Intergenic
1025901995 7:65751907-65751929 ATAAATAAATAAAGCAAGCTGGG - Intergenic
1026072460 7:67134245-67134267 ATAGATAAATAAAAGGGGCTGGG + Intronic
1026158072 7:67844734-67844756 ACAAATAAATAGAAGGTCTTTGG + Intergenic
1026162214 7:67879884-67879906 ATAAATAAATCTAAGGAGTTTGG - Intergenic
1026214156 7:68333426-68333448 ATAAAGAAATTTAAGTAGCTAGG - Intergenic
1026632431 7:72048969-72048991 ACAAAAAAATAAAAGTAGCTGGG - Intronic
1026686053 7:72511126-72511148 ATAAAAAAATACAAACAGCTGGG - Intergenic
1026704439 7:72677995-72678017 ATAGATAAATAAAAGGTGCTGGG - Intronic
1026825228 7:73577575-73577597 AAAAATAAATAAAAAGAGCAGGG + Intronic
1026887560 7:73962156-73962178 ATAAATAAATAAAATTAGCTGGG - Intergenic
1026965079 7:74434344-74434366 ATAAATAAATAAAATTGGCTGGG + Intergenic
1026974039 7:74485624-74485646 AAAAAAAAATAGATGCAGCTGGG + Intronic
1026990417 7:74582016-74582038 ATAAATAAATAAATAAAGCTTGG + Intronic
1026990589 7:74583016-74583038 TTAAATAAAAAGAAAGAGGTAGG + Intronic
1027515018 7:79130976-79130998 ATAAATTTATAGAAGGAACAGGG + Intronic
1027638075 7:80700982-80701004 ATAGATGAATAGAAGATGCTAGG - Intergenic
1027925615 7:84459060-84459082 AAAATTAAAAAGCAGGAGCTGGG - Intronic
1028403408 7:90448839-90448861 ATAAATAAATAAAAAGAGATGGG + Intronic
1029025905 7:97416883-97416905 AAAAACAAATGGAAGGAGATCGG - Intergenic
1029134150 7:98356679-98356701 AAAAAAAAATTGAAGGGGCTGGG + Intronic
1029177183 7:98673155-98673177 AAAAAAAAAAAAAAGGAGCTAGG - Intergenic
1029327062 7:99818852-99818874 ATAAAAAAATAAAATTAGCTAGG + Intergenic
1029684252 7:102134756-102134778 AAAAATAAAAAGAATTAGCTGGG - Intronic
1029907628 7:104107499-104107521 ATAAATAACTAGAGGGCACTAGG - Intergenic
1030235550 7:107257012-107257034 ATTAATAAATACTAAGAGCTAGG + Intronic
1030879435 7:114858879-114858901 ATGAATAAGTAGGATGAGCTTGG + Intergenic
1030959928 7:115905622-115905644 ACAACTAAATAGATGGAGGTGGG - Intergenic
1031518668 7:122735327-122735349 ATATGTAAGTTGAAGGAGCTGGG - Intronic
1031663816 7:124460287-124460309 AAAGATAAATAGGATGAGCTGGG + Intergenic
1031690350 7:124780653-124780675 ATAAATAAATAGAGAAATCTTGG - Intronic
1031716448 7:125114567-125114589 ATAAATATATATAATGAGGTAGG - Intergenic
1031723956 7:125212791-125212813 CTGCATCAATAGAAGGAGCTTGG + Intergenic
1032029719 7:128473001-128473023 ATAAATAAATAAAATTAGCCGGG - Intergenic
1032343675 7:131099600-131099622 CTAAATAAATAAAAGGCACTTGG + Intergenic
1032549929 7:132775529-132775551 ATTAATAAATAAAAGGAGAAAGG - Intergenic
1033039071 7:137901890-137901912 AAAGAAAAATAGAAGGAGCTGGG + Intronic
1033045245 7:137956158-137956180 ATAAATAATTAGAAGGCCTTTGG - Intronic
1033078688 7:138273540-138273562 ATAAATAAATATAAATAACTGGG + Intergenic
1033229804 7:139587888-139587910 ATAAATAAATAAAAATAGTTAGG + Intronic
1033326483 7:140383306-140383328 ATTAAAAGAAAGAAGGAGCTGGG + Intronic
1033445568 7:141418896-141418918 ATAAATAAATAAAAATAGCATGG - Intronic
1033899492 7:146117342-146117364 ATAAATAAAAATAAGAAACTTGG - Intronic
1033972298 7:147056929-147056951 ATAAATAAAAAAAATAAGCTAGG - Intronic
1034016246 7:147590190-147590212 AAAAATAAATAAAAGAAGATAGG - Intronic
1034073111 7:148206959-148206981 AGAAATAAATAGCAGGAGGCGGG - Intronic
1034173020 7:149077640-149077662 ATAAATAAATAAAAGAAGATGGG + Intronic
1034507203 7:151502234-151502256 AAAAAAAAAAAAAAGGAGCTTGG + Intronic
1034903284 7:154921365-154921387 ATATATAAAAAAAAAGAGCTGGG + Intergenic
1035090393 7:156305507-156305529 ATAAATGAACACAAGGAGCCAGG + Intergenic
1035152453 7:156885878-156885900 ATAAATAAATAAAATTAGCCAGG + Intronic
1036082237 8:5569425-5569447 ATAAATATATAGAAGGAGGTAGG + Intergenic
1036251966 8:7170166-7170188 ATAAATGGAGAGAGGGAGCTCGG - Intergenic
1036365524 8:8117295-8117317 ATAAATGGAGAGAGGGAGCTCGG + Intergenic
1036617454 8:10399646-10399668 ATAAATAAATATCAGAGGCTGGG - Intronic
1036801248 8:11794388-11794410 ATAAATACATAAAAGGAGGTAGG + Intergenic
1036930235 8:12949841-12949863 ATAAATAAATAGAATTAACTAGG - Intronic
1037061248 8:14512450-14512472 ATAAATAAATAAATGGATTTGGG - Intronic
1037087158 8:14866647-14866669 AAAAATACAAAGAATGAGCTGGG + Intronic
1037366948 8:18132952-18132974 ATCAATAAAAAGAAGAATCTTGG + Intergenic
1037512411 8:19597453-19597475 ATAAATAAATAAAATTAGCTAGG - Intronic
1037867464 8:22457313-22457335 ATAAATAAATAAATGAAGATGGG - Intronic
1037995214 8:23347365-23347387 ATAAATAAATAGGTGGGGCACGG + Intronic
1038256904 8:25958633-25958655 TTAAAAAATTAGAAGAAGCTGGG - Intronic
1038557032 8:28528912-28528934 ATAAATACATAAAAGAAGGTAGG - Intronic
1038754137 8:30325215-30325237 ATAAAAAATTAAAATGAGCTGGG + Intergenic
1038836221 8:31127761-31127783 ATAAATAAAAAAAATTAGCTAGG + Intronic
1038883547 8:31639851-31639873 ATAAATAAATAAAAGGAGGAGGG + Intronic
1038944371 8:32341154-32341176 ATAAATGTATACAAGAAGCTGGG - Intronic
1039189944 8:34962473-34962495 ATAAATAAATAGAAGGTTGAAGG - Intergenic
1039294712 8:36137897-36137919 ATAAACAAATAGAAGCAAATAGG + Intergenic
1039645110 8:39273364-39273386 ATAAATAAATAAAATTAGCCAGG + Intronic
1039816570 8:41099993-41100015 ATAAATAAAAAGAAGGAAGAAGG - Intergenic
1039831254 8:41216827-41216849 ATAAATGAATAAAATTAGCTGGG - Intergenic
1040590851 8:48790631-48790653 ATAAATAAATGCAAGGTGCCAGG - Intergenic
1040659688 8:49556915-49556937 ATAAAGAAATACAAGGAGGCTGG + Intergenic
1041014619 8:53579842-53579864 ATAAATAAATAAAAGTATGTAGG - Intergenic
1041180791 8:55245939-55245961 ATAAATAAATAAAATTAGCTGGG + Intronic
1041246884 8:55896723-55896745 ATAAATAAACGTGAGGAGCTTGG - Intronic
1041488685 8:58408363-58408385 ATAAATAAAAATAAAGAGCCTGG + Intergenic
1041626495 8:60034778-60034800 AGAGATAAAGAGAAGGAGGTAGG - Intergenic
1041729445 8:61050196-61050218 ATAAAAACATACAAGGAGGTAGG - Intergenic
1042265086 8:66900139-66900161 ATAAATAAATAAAATAGGCTAGG + Intronic
1042507323 8:69574483-69574505 ATATAAAAATAGAGGGAACTTGG - Intronic
1042518767 8:69688191-69688213 GACTATAAATAGAAGGAGCTAGG + Intronic
1042765158 8:72313569-72313591 ATAAATAAATGGGAGGAGCAGGG - Intergenic
1043606595 8:82008122-82008144 ATAAATATAGAGAAGAATCTGGG + Intergenic
1043813044 8:84766561-84766583 ATAAATAAATAAAATTAGCCAGG + Intronic
1043822924 8:84890810-84890832 AACAATAAATAAAAGGAGTTAGG + Intronic
1043873295 8:85459134-85459156 ATGAATAAAAGCAAGGAGCTAGG + Intergenic
1043968045 8:86501375-86501397 AGAAATAGAGATAAGGAGCTGGG + Intronic
1043974223 8:86566988-86567010 ATAAATAAATAAAATTAGCTGGG - Intronic
1044554238 8:93544704-93544726 ATAAATAAAAAGAAGGAGTAAGG + Intergenic
1044673726 8:94709398-94709420 ATAAATAAATAAATAAAGCTGGG - Intergenic
1044683109 8:94801508-94801530 ATAAATAAAAAGCAGAAGTTTGG + Intergenic
1044704969 8:94999710-94999732 AAAAATAAATAGAATGGGCCCGG - Intronic
1044708079 8:95027417-95027439 AAAAATAAATAAAATTAGCTGGG + Intronic
1044941323 8:97347206-97347228 ATAAATAAATAAAAGGAGCCTGG - Intergenic
1045081212 8:98627712-98627734 ATAAATAAATACCTGAAGCTGGG - Intronic
1045142347 8:99300670-99300692 ATAACTAAAGAAAAGGAACTGGG - Intronic
1045308696 8:100981746-100981768 ATAAATAAATAGAGGGTGTGAGG + Intergenic
1045422874 8:102033968-102033990 AGAAAGAAAGAGAAAGAGCTAGG - Intronic
1045660503 8:104432626-104432648 GCAAATACATAGAAGCAGCTTGG + Intronic
1045872096 8:106938957-106938979 CTAAATACACAAAAGGAGCTGGG - Intergenic
1046953907 8:120044143-120044165 ATAAATAAAAATAAAAAGCTTGG - Intronic
1047428544 8:124768938-124768960 ATAAATGGATAGATGTAGCTGGG + Intergenic
1047598134 8:126399298-126399320 ATAAATAAATAAAATTAGCCAGG + Intergenic
1048015972 8:130498336-130498358 ATAAATAAATAAAAGGAGGAGGG - Intergenic
1048420737 8:134275820-134275842 AAAAAAGAAGAGAAGGAGCTAGG - Intergenic
1048676760 8:136792680-136792702 ATAAATAAATAAAAACAGCCAGG - Intergenic
1048703440 8:137121262-137121284 ATAAATAAATAGATAGAGGTTGG + Intergenic
1049832286 8:144709339-144709361 ACAAATAAATAAAATTAGCTAGG + Intergenic
1049926838 9:417294-417316 ATAAATAAATAATAAGAACTGGG + Intronic
1049968111 9:797623-797645 AAAAATAAATAAAAGAAACTGGG - Intergenic
1049975141 9:854272-854294 ATAAATTAATAAAATTAGCTGGG - Intronic
1050309868 9:4341612-4341634 ATCAATAAATGGGATGAGCTTGG - Intronic
1050543610 9:6691106-6691128 AAAAATAAATAAAAATAGCTAGG - Intergenic
1050635309 9:7606121-7606143 ATAAATAAATGGATGGAGTGGGG - Intergenic
1050687192 9:8184998-8185020 ATAAATAAATAGAAAAAGACAGG + Intergenic
1050696114 9:8281184-8281206 AAAAAAAAATACAAGAAGCTGGG + Intergenic
1051700737 9:19820553-19820575 ATAAATAAAAATAAAGAGTTAGG + Intergenic
1051897890 9:22007375-22007397 ATAAATAAATAAATAGAGCTTGG + Intronic
1052001961 9:23294846-23294868 ATAAATAAAAAGCATGAGATAGG + Intergenic
1052707007 9:32006431-32006453 ATAAATAAATAAGTGGTGCTGGG - Intergenic
1052754289 9:32525027-32525049 ATAAATAATTTCAAGGAGCCTGG - Intronic
1052758873 9:32569377-32569399 AAAAATAAAAAAAATGAGCTGGG - Intronic
1052883999 9:33625527-33625549 ATAAATAAATGTAAGGGGCGCGG + Intergenic
1052892394 9:33715391-33715413 ATAAATAAATAAAATTAGCTGGG + Intergenic
1052914486 9:33914009-33914031 AGAAATATATAGAAGTACCTTGG - Intronic
1053234173 9:36437530-36437552 ACAAATTTATAGAAGGAGCAAGG + Intronic
1054703655 9:68439603-68439625 ATAAAATATTAGAATGAGCTGGG - Intronic
1054711939 9:68519927-68519949 ATAAATAAATAAAATTAGCCAGG + Intronic
1054875848 9:70095878-70095900 ATGTAAAAATAGCAGGAGCTGGG - Intronic
1054898686 9:70343402-70343424 ATAAATACATGGAAGGTACTTGG + Intronic
1054984415 9:71245151-71245173 ATAAATACAAAGAAGAGGCTGGG + Intronic
1055031457 9:71774500-71774522 ATAAATAAATAAAATTAGCCAGG - Intronic
1055105104 9:72504051-72504073 ATGAATAAATAGAAGGTTCCTGG + Intergenic
1055196221 9:73597571-73597593 AGAGAAAAAGAGAAGGAGCTAGG + Intergenic
1055253855 9:74342961-74342983 AAAAATAAATACAAGTGGCTGGG + Intergenic
1055280287 9:74666298-74666320 ATAAATAAATAAAATTAGCTGGG + Intronic
1055301625 9:74888617-74888639 ATAAATAAATAAAATTAGCCAGG - Intergenic
1055309816 9:74967073-74967095 ATAAATAAGTAGCATGGGCTGGG + Intergenic
1055322816 9:75099095-75099117 ATAAATACAAAAAAGTAGCTGGG - Intronic
1055378142 9:75673389-75673411 ATAAATAAATAAATAAAGCTGGG - Intergenic
1055392660 9:75839906-75839928 ATAAAATTATAGGAGGAGCTAGG + Intergenic
1055536939 9:77257603-77257625 ATAATTAAATAAAATTAGCTGGG + Intronic
1055856698 9:80696944-80696966 ATAAAGAAATATTTGGAGCTGGG + Intergenic
1055864697 9:80798649-80798671 AGAAAAAAATAGAAGGATGTGGG + Intergenic
1055879868 9:80987822-80987844 ATAAATAAATAACTGAAGCTGGG - Intergenic
1055959929 9:81810633-81810655 GTAAATAAATAGATGGAGCTGGG + Intergenic
1056136414 9:83633343-83633365 ATAAAAAAATAAAAGAAGATTGG + Intronic
1056194865 9:84219360-84219382 ATAAATAAATAAAAGGATCTAGG - Intergenic
1056589723 9:87956732-87956754 GTAAAGAAATAGAATCAGCTGGG - Intergenic
1056670556 9:88624340-88624362 ATAAAGAAATACCAGAAGCTGGG + Intergenic
1056797007 9:89665403-89665425 ATAAATAAATAAATGAGGCTAGG - Intergenic
1056869114 9:90260359-90260381 ATAAATAAAGTGAAGTGGCTTGG + Intergenic
1057567641 9:96179398-96179420 ATACATAAATAGAAGAAAATGGG + Intergenic
1057970852 9:99556150-99556172 AAAAATAAATAAAAGAACCTAGG + Intergenic
1058142474 9:101371933-101371955 ATAAAAAAATAGAGGGATCATGG + Intronic
1058218562 9:102266323-102266345 ATAGATAGATAGATGGTGCTGGG + Intergenic
1058469420 9:105261938-105261960 ATAAAAAAATAAAATTAGCTGGG - Intronic
1058553653 9:106142420-106142442 ACAAAGAAACAGAAGCAGCTCGG + Intergenic
1058683748 9:107463152-107463174 TTAAATAAATAGGCTGAGCTTGG + Intergenic
1058731363 9:107853485-107853507 ATAAATAAATAAAGTGAGATGGG - Intergenic
1058968318 9:110057351-110057373 AAAAAAACAGAGAAGGAGCTGGG - Intronic
1059030677 9:110692318-110692340 ATAAATAAATAAAAGTAGCCTGG - Intronic
1059127479 9:111705410-111705432 AAAAAAAAAGAGAAAGAGCTGGG - Intronic
1059830680 9:118092028-118092050 ATAAGTAAATAGGAAGAGATGGG + Intergenic
1059860743 9:118458383-118458405 AAAAATAAATAGATGCAGATAGG + Intergenic
1059996785 9:119918333-119918355 ATGAATCAATAGTAGGAGCAGGG - Intergenic
1060028305 9:120191782-120191804 ATAAATGAAATGAAGGAGCAGGG + Intergenic
1060164340 9:121397463-121397485 ATAAATAAATAAATAGTGCTGGG - Intergenic
1060296087 9:122343777-122343799 AAAAATAAAAAGAATTAGCTGGG - Intergenic
1060415347 9:123425965-123425987 ACAAATAAATACGAGGCGCTAGG + Intronic
1060624223 9:125095829-125095851 ACAAAAGAATAGAAGGAGCCTGG + Intronic
1060673300 9:125489775-125489797 AGAAAGAAAGAGAAGGTGCTGGG + Intronic
1060915595 9:127387848-127387870 ATAAATAAATAAACTGGGCTAGG + Intronic
1061137486 9:128743410-128743432 ATAAATAAATAAAAGAAGGCTGG - Intronic
1061153339 9:128842029-128842051 ATATATAAATAAAATTAGCTGGG + Intronic
1061159842 9:128887317-128887339 ATAAATAAATAAAATTAGCTGGG - Intronic
1061223299 9:129265043-129265065 ATAAATAAATAGAAGGAGGCTGG - Intergenic
1061332906 9:129908137-129908159 AAAAATAAACAAAAGTAGCTGGG - Intronic
1061383342 9:130272856-130272878 ATGAATAAAAAGAAGATGCTCGG - Intergenic
1061435315 9:130557603-130557625 ATAAATAAATAGAAGTGCCATGG - Intergenic
1061562064 9:131411094-131411116 AAAAATAAAAAGAATTAGCTGGG + Intronic
1061576258 9:131508536-131508558 ATAAATAAATAAAATTAGCCAGG + Intronic
1061944296 9:133900036-133900058 ATAAATAAATAAAAATAGCTGGG + Intronic
1062286717 9:135776416-135776438 ATAAATAAATAAAATTAGCCAGG - Intronic
1062709366 9:137965564-137965586 ATAAATAAATAAAATGAAGTAGG - Intronic
1203652040 Un_KI270751v1:134584-134606 ATAAAAAAAAAGAAGGAGGTTGG + Intergenic
1185590414 X:1272784-1272806 AAAAAGAAAAAGAAGAAGCTAGG - Intronic
1185726154 X:2423429-2423451 ATAAATAAATAAAATGAGCTTGG + Intronic
1186018136 X:5222659-5222681 ATGAATAGATGGCAGGAGCTTGG - Intergenic
1186371136 X:8948635-8948657 ATATATAAATAAAAGGATATGGG + Intergenic
1186423320 X:9443812-9443834 ATAAATAAATAAAATTAGCTGGG + Intergenic
1187032804 X:15505219-15505241 AGAAGTAAATAGAAGGAGAAAGG + Intronic
1187148840 X:16663304-16663326 ATAAATAAATAAAATTACCTGGG - Intronic
1187953949 X:24497265-24497287 ATAAATAAATAAAAGTCTCTGGG - Intronic
1187980056 X:24747150-24747172 AGAAAAAAAAAAAAGGAGCTTGG - Intronic
1188016139 X:25110438-25110460 TTAAAAAAATAGAAACAGCTGGG - Intergenic
1188060292 X:25592608-25592630 AGAAATAAATAGTAGTTGCTTGG + Intergenic
1188209423 X:27403983-27404005 ATATATTAATAGAAAAAGCTTGG + Intergenic
1188300915 X:28505035-28505057 GTAAATCATTAGAAAGAGCTTGG + Intergenic
1188484340 X:30666827-30666849 ATAAATACACAGAAGGAGACTGG + Intronic
1188600802 X:31961195-31961217 TTAAAAAAATGGAAGGAGTTTGG - Intronic
1188630091 X:32345488-32345510 AAAAATAAATAAAAGAATCTAGG + Intronic
1188742008 X:33796059-33796081 ATAAAAAAATAAAAGGAGGTAGG - Intergenic
1189098800 X:38167919-38167941 ATGAATAAATAAAATCAGCTAGG - Intronic
1189372532 X:40440300-40440322 ATAAATAAATAAACAGAGCCTGG - Intergenic
1189743512 X:44145724-44145746 AGAAATAAATAGAAAAGGCTAGG + Intergenic
1189813837 X:44805218-44805240 ATAAATAAACAAAATTAGCTGGG - Intergenic
1190211503 X:48452292-48452314 ATAAATAAATTAAATTAGCTTGG - Intergenic
1190231768 X:48587669-48587691 AAAAATAAATAAAATAAGCTGGG - Intergenic
1190460014 X:50663240-50663262 AAACAAAAATAGAAAGAGCTAGG - Intronic
1190741948 X:53294791-53294813 ATAAATAAATAAAAGGCTGTGGG - Intronic
1190758984 X:53424078-53424100 ATAAATAAAGGGAGGAAGCTTGG + Intronic
1190863639 X:54366609-54366631 ATAAATAAATAAAAGAACCTAGG + Intergenic
1190883288 X:54508888-54508910 AAAAAAAAATAGAAGGAGGCTGG - Intergenic
1191015528 X:55806021-55806043 AAAAATAAAAAGAAAGAGCAAGG - Intergenic
1191749151 X:64522490-64522512 GTAAATGAATGGAAGGAGGTGGG - Intergenic
1192043126 X:67644086-67644108 CTAAATAAAACTAAGGAGCTAGG - Intronic
1192121281 X:68458572-68458594 ATAAATAAATAAAACCAGCCTGG - Intergenic
1192405654 X:70883423-70883445 ATAAATAAATAAAATTAGCCAGG + Intronic
1192408341 X:70909619-70909641 ATAAATAAATAGGCCGAGCACGG + Intergenic
1193111526 X:77735115-77735137 ATAAATAAATAAATGGTGCCGGG + Intronic
1193294560 X:79819470-79819492 ATAAAAAAATAGAGGGAGAAAGG + Intergenic
1193757912 X:85431310-85431332 ATAAATATAAAGGAGGAGATAGG + Intergenic
1194112850 X:89856148-89856170 ATAAATAAATACAAAGAGATAGG + Intergenic
1194602171 X:95935493-95935515 ATACATAAATAGAAACAGATAGG + Intergenic
1194729617 X:97438524-97438546 ATAAATAAGTAAAAATAGCTGGG - Intronic
1194904220 X:99553761-99553783 ATAAATAAATAAAATTAGCCAGG + Intergenic
1194973099 X:100365860-100365882 AGAACTAACAAGAAGGAGCTGGG - Intronic
1195062163 X:101206848-101206870 ATAAATAAATAAAATTAGCTGGG - Intergenic
1195145888 X:102017084-102017106 ATAAATAAATAGCATGGTCTGGG - Intergenic
1195494133 X:105510017-105510039 ATAAATAAATAAAATTAGCTTGG + Intronic
1195711998 X:107780338-107780360 ATTAATATATATAAGGAGGTTGG - Intronic
1196071185 X:111524157-111524179 ATAAAGAAGTATAAGGTGCTTGG + Intergenic
1196652220 X:118179587-118179609 ATATAGAAAGAGATGGAGCTGGG + Intergenic
1197907981 X:131446829-131446851 ATAGATAAATAGACTGATCTAGG - Intergenic
1197973746 X:132142647-132142669 ATAAATCAATTGAAGAACCTGGG + Intergenic
1198251890 X:134887124-134887146 ATAAAGAAACAGAAGTAGCCTGG + Intergenic
1198596699 X:138243746-138243768 ATAAATAAATAAATAGTGCTGGG + Intergenic
1199179257 X:144834341-144834363 AGAAATAAAAAGAATGGGCTGGG + Intergenic
1199189432 X:144952754-144952776 ATAAATAAATACAAGAGACTGGG + Intergenic
1199767386 X:150951156-150951178 ATAAATAAATAAAATTAGCTGGG - Intergenic
1199901414 X:152176100-152176122 ATAAATAAATAGAATCATCAAGG + Intronic
1199920723 X:152400346-152400368 ATAAATAAATAAAATTAGCTGGG + Intronic
1200226848 X:154422393-154422415 AAATATAGATAGAAGCAGCTGGG + Intergenic
1200465503 Y:3510961-3510983 ATAAATAAATACAAAGAGATAGG + Intergenic
1201171978 Y:11275858-11275880 AAAAAAAAAAAGAAGGAGGTTGG + Intergenic
1201245112 Y:11995865-11995887 ATAGATAAATAGAAGATGCATGG + Intergenic
1201601118 Y:15729504-15729526 TTAAATACTTAGCAGGAGCTAGG + Intergenic
1201951559 Y:19570642-19570664 ATAAATATATTCAAAGAGCTAGG - Intergenic
1202087489 Y:21154121-21154143 ATAAATAAATAAAGTGGGCTGGG - Intergenic