ID: 1138006191

View in Genome Browser
Species Human (GRCh38)
Location 16:53340095-53340117
Sequence ATGGATTTAGTACCAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138006191_1138006194 0 Left 1138006191 16:53340095-53340117 CCAGTCTTTGGTACTAAATCCAT No data
Right 1138006194 16:53340118-53340140 CTATACAAGGACACTCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138006191 Original CRISPR ATGGATTTAGTACCAAAGAC TGG (reversed) Intergenic
No off target data available for this crispr