ID: 1138008372

View in Genome Browser
Species Human (GRCh38)
Location 16:53357374-53357396
Sequence CAGTGGGACTTGAGAGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138008356_1138008372 27 Left 1138008356 16:53357324-53357346 CCCACAGCCTGCAGAGCAGCCCT No data
Right 1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG No data
1138008363_1138008372 7 Left 1138008363 16:53357344-53357366 CCTGGACTCGGGAGCCCGCTCAC No data
Right 1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG No data
1138008367_1138008372 -8 Left 1138008367 16:53357359-53357381 CCGCTCACACCAGCCCAGTGGGA No data
Right 1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG No data
1138008365_1138008372 -7 Left 1138008365 16:53357358-53357380 CCCGCTCACACCAGCCCAGTGGG No data
Right 1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG No data
1138008355_1138008372 28 Left 1138008355 16:53357323-53357345 CCCCACAGCCTGCAGAGCAGCCC No data
Right 1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG No data
1138008362_1138008372 8 Left 1138008362 16:53357343-53357365 CCCTGGACTCGGGAGCCCGCTCA No data
Right 1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG No data
1138008357_1138008372 26 Left 1138008357 16:53357325-53357347 CCACAGCCTGCAGAGCAGCCCTG No data
Right 1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG No data
1138008359_1138008372 20 Left 1138008359 16:53357331-53357353 CCTGCAGAGCAGCCCTGGACTCG No data
Right 1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138008372 Original CRISPR CAGTGGGACTTGAGAGATGT GGG Intergenic
No off target data available for this crispr