ID: 1138009418

View in Genome Browser
Species Human (GRCh38)
Location 16:53363502-53363524
Sequence CCCTTGGGCCCTCTGTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138009409_1138009418 6 Left 1138009409 16:53363473-53363495 CCACAATCTTAACAATTACCCTC No data
Right 1138009418 16:53363502-53363524 CCCTTGGGCCCTCTGTCTCCAGG No data
1138009407_1138009418 25 Left 1138009407 16:53363454-53363476 CCGGTACCTGGCAGTTCTTCCAC No data
Right 1138009418 16:53363502-53363524 CCCTTGGGCCCTCTGTCTCCAGG No data
1138009408_1138009418 19 Left 1138009408 16:53363460-53363482 CCTGGCAGTTCTTCCACAATCTT No data
Right 1138009418 16:53363502-53363524 CCCTTGGGCCCTCTGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138009418 Original CRISPR CCCTTGGGCCCTCTGTCTCC AGG Intergenic
No off target data available for this crispr