ID: 1138010837

View in Genome Browser
Species Human (GRCh38)
Location 16:53378394-53378416
Sequence CCCCACTGACCTACCTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138010837_1138010845 11 Left 1138010837 16:53378394-53378416 CCTTTTAAGGTAGGTCAGTGGGG No data
Right 1138010845 16:53378428-53378450 TTAGGTAACAGGGCGGCTAATGG No data
1138010837_1138010842 0 Left 1138010837 16:53378394-53378416 CCTTTTAAGGTAGGTCAGTGGGG No data
Right 1138010842 16:53378417-53378439 AAAACAAGGGCTTAGGTAACAGG No data
1138010837_1138010841 -7 Left 1138010837 16:53378394-53378416 CCTTTTAAGGTAGGTCAGTGGGG No data
Right 1138010841 16:53378410-53378432 AGTGGGGAAAACAAGGGCTTAGG No data
1138010837_1138010843 1 Left 1138010837 16:53378394-53378416 CCTTTTAAGGTAGGTCAGTGGGG No data
Right 1138010843 16:53378418-53378440 AAACAAGGGCTTAGGTAACAGGG No data
1138010837_1138010847 20 Left 1138010837 16:53378394-53378416 CCTTTTAAGGTAGGTCAGTGGGG No data
Right 1138010847 16:53378437-53378459 AGGGCGGCTAATGGGCCCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 116
1138010837_1138010844 4 Left 1138010837 16:53378394-53378416 CCTTTTAAGGTAGGTCAGTGGGG No data
Right 1138010844 16:53378421-53378443 CAAGGGCTTAGGTAACAGGGCGG No data
1138010837_1138010846 12 Left 1138010837 16:53378394-53378416 CCTTTTAAGGTAGGTCAGTGGGG No data
Right 1138010846 16:53378429-53378451 TAGGTAACAGGGCGGCTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138010837 Original CRISPR CCCCACTGACCTACCTTAAA AGG (reversed) Intergenic